Incidental Mutation 'R2321:Tasp1'
ID245625
Institutional Source Beutler Lab
Gene Symbol Tasp1
Ensembl Gene ENSMUSG00000039033
Gene Nametaspase, threonine aspartase 1
Synonyms
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location139833480-140066805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140057412 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 7 (M7T)
Ref Sequence ENSEMBL: ENSMUSP00000096907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046656] [ENSMUST00000099304] [ENSMUST00000110079]
Predicted Effect probably benign
Transcript: ENSMUST00000046656
AA Change: M7T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000039546
Gene: ENSMUSG00000039033
AA Change: M7T

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 346 1.1e-50 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099304
AA Change: M7T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096907
Gene: ENSMUSG00000039033
AA Change: M7T

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 286 1.1e-46 PFAM
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110079
AA Change: M7T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105706
Gene: ENSMUSG00000039033
AA Change: M7T

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 348 1.3e-62 PFAM
Meta Mutation Damage Score 0.0686 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endopeptidase that cleaves specific substrates following aspartate residues. The encoded protein undergoes posttranslational autoproteolytic processing to generate alpha and beta subunits, which reassemble into the active alpha2-beta2 heterotetramer. It is required to cleave MLL, a protein required for the maintenance of HOX gene expression, and TFIIA, a basal transcription factor. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display prenatal and early postnatal lethality, reduced body size, impaired suckling behavior, homeotic transformations of the axial skeleton, and cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Tasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Tasp1 APN 2 139977618 missense probably damaging 1.00
IGL01476:Tasp1 APN 2 140008773 missense probably benign 0.01
IGL02876:Tasp1 APN 2 139834363 missense probably benign 0.45
PIT4449001:Tasp1 UTSW 2 139910535 missense possibly damaging 0.67
R0352:Tasp1 UTSW 2 139951458 critical splice donor site probably null
R0381:Tasp1 UTSW 2 139951483 missense probably damaging 1.00
R1056:Tasp1 UTSW 2 140008764 missense possibly damaging 0.94
R1350:Tasp1 UTSW 2 140057421 missense probably damaging 1.00
R1836:Tasp1 UTSW 2 139951557 missense probably damaging 1.00
R2005:Tasp1 UTSW 2 139977678 missense probably damaging 1.00
R2129:Tasp1 UTSW 2 140048244 missense possibly damaging 0.75
R2259:Tasp1 UTSW 2 139951506 missense probably damaging 1.00
R3700:Tasp1 UTSW 2 139910554 missense probably benign 0.00
R3842:Tasp1 UTSW 2 139951501 missense probably damaging 1.00
R5526:Tasp1 UTSW 2 140008789 missense probably damaging 1.00
R5724:Tasp1 UTSW 2 140057419 missense probably damaging 0.99
R6345:Tasp1 UTSW 2 139951537 missense probably damaging 1.00
R6533:Tasp1 UTSW 2 139834357 makesense probably null
R7723:Tasp1 UTSW 2 139985131 missense probably damaging 1.00
R7796:Tasp1 UTSW 2 140008785 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCCTCAGTGTTGTTCAAAGC -3'
(R):5'- GTTGCTGGACAGAGATTTAACTTG -3'

Sequencing Primer
(F):5'- CTCAGTGTTGTTCAAAGCAAGAAAAG -3'
(R):5'- GCTGGACAGAGATTTAACTTGTAAAC -3'
Posted On2014-10-30