Incidental Mutation 'R2321:Otol1'
ID245627
Institutional Source Beutler Lab
Gene Symbol Otol1
Ensembl Gene ENSMUSG00000027788
Gene Nameotolin 1
SynonymsGm414, LOC229389
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location70007613-70028708 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 70018525 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 11 (L11*)
Ref Sequence ENSEMBL: ENSMUSP00000057607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053013]
Predicted Effect probably null
Transcript: ENSMUST00000053013
AA Change: L11*
SMART Domains Protein: ENSMUSP00000057607
Gene: ENSMUSG00000027788
AA Change: L11*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Collagen 116 175 8.8e-11 PFAM
internal_repeat_2 183 229 1.02e-7 PROSPERO
Pfam:Collagen 232 302 2.4e-9 PFAM
low complexity region 328 340 N/A INTRINSIC
C1Q 341 475 9.83e-51 SMART
Meta Mutation Damage Score 0.9668 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Otol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Otol1 APN 3 70027724 missense probably damaging 1.00
IGL01664:Otol1 APN 3 70027797 missense probably benign 0.01
IGL02205:Otol1 APN 3 70018596 missense probably benign
IGL02445:Otol1 APN 3 70028034 missense probably damaging 1.00
IGL02674:Otol1 APN 3 70018744 missense probably benign 0.01
IGL03376:Otol1 APN 3 70027512 missense probably damaging 0.96
R0094:Otol1 UTSW 3 70018683 missense probably benign 0.03
R0492:Otol1 UTSW 3 70027784 missense probably damaging 0.99
R0504:Otol1 UTSW 3 70027604 missense probably damaging 1.00
R1932:Otol1 UTSW 3 70028104 missense probably benign 0.01
R2049:Otol1 UTSW 3 70018836 missense probably benign 0.06
R4042:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4043:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4044:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4092:Otol1 UTSW 3 70027785 missense probably damaging 0.99
R4433:Otol1 UTSW 3 70018548 missense probably benign 0.02
R4993:Otol1 UTSW 3 70018878 missense probably benign 0.07
R6921:Otol1 UTSW 3 70028100 missense possibly damaging 0.89
R6983:Otol1 UTSW 3 70028041 missense probably damaging 1.00
R7095:Otol1 UTSW 3 70018694 missense probably benign 0.00
R7619:Otol1 UTSW 3 70027869 missense probably damaging 1.00
RF019:Otol1 UTSW 3 70018600 missense probably benign 0.00
X0062:Otol1 UTSW 3 70027640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGCCCCATGGTGACTCAC -3'
(R):5'- TGGACTCAGCCATTGCCAAG -3'

Sequencing Primer
(F):5'- TACACTTACATAGAAAACAGACCAGC -3'
(R):5'- CAGGGGAGCCGGTGGTG -3'
Posted On2014-10-30