Incidental Mutation 'R2321:Crybg2'
ID245634
Institutional Source Beutler Lab
Gene Symbol Crybg2
Ensembl Gene ENSMUSG00000012123
Gene Namecrystallin beta-gamma domain containing 2
SynonymsAim1l
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.802) question?
Stock #R2321 (G1)
Quality Score125
Status Validated
Chromosome4
Chromosomal Location134060815-134092504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134074511 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 994 (E994G)
Ref Sequence ENSEMBL: ENSMUSP00000154159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121391] [ENSMUST00000137053] [ENSMUST00000149956] [ENSMUST00000219402] [ENSMUST00000227683]
Predicted Effect probably benign
Transcript: ENSMUST00000121391
AA Change: E685G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114099
Gene: ENSMUSG00000012123
AA Change: E685G

DomainStartEndE-ValueType
low complexity region 171 205 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
low complexity region 414 443 N/A INTRINSIC
low complexity region 560 582 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
coiled coil region 683 703 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
XTALbg 842 921 2.56e-7 SMART
XTALbg 929 1010 9.33e-10 SMART
XTALbg 1024 1110 5.06e-29 SMART
XTALbg 1118 1199 1.4e-22 SMART
XTALbg 1212 1291 2.22e-16 SMART
XTALbg 1299 1379 1.69e-16 SMART
RICIN 1383 1514 7.89e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149504
Predicted Effect probably benign
Transcript: ENSMUST00000149956
SMART Domains Protein: ENSMUSP00000123349
Gene: ENSMUSG00000012123

DomainStartEndE-ValueType
XTALbg 1 60 1.39e-2 SMART
XTALbg 62 148 3.99e-27 SMART
XTALbg 156 237 1.4e-22 SMART
XTALbg 250 293 7.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219402
Predicted Effect probably benign
Transcript: ENSMUST00000227683
AA Change: E994G

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0674 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Crybg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Crybg2 APN 4 134075444 missense possibly damaging 0.57
IGL01147:Crybg2 APN 4 134089264 splice site probably null
IGL02003:Crybg2 APN 4 134072456 missense probably benign
IGL02468:Crybg2 APN 4 134082587 missense probably damaging 1.00
R0089:Crybg2 UTSW 4 134081194 missense probably damaging 1.00
R0414:Crybg2 UTSW 4 134072636 small deletion probably benign
R0579:Crybg2 UTSW 4 134072738 missense probably damaging 0.97
R0634:Crybg2 UTSW 4 134075304 splice site probably benign
R0638:Crybg2 UTSW 4 134074454 missense probably damaging 1.00
R0686:Crybg2 UTSW 4 134074526 small deletion probably benign
R1583:Crybg2 UTSW 4 134081459 missense probably damaging 1.00
R1651:Crybg2 UTSW 4 134074825 missense possibly damaging 0.84
R1651:Crybg2 UTSW 4 134074903 missense probably benign 0.07
R1752:Crybg2 UTSW 4 134073650 missense probably damaging 0.96
R1883:Crybg2 UTSW 4 134074283 nonsense probably null
R1903:Crybg2 UTSW 4 134078856 missense probably damaging 1.00
R2042:Crybg2 UTSW 4 134087533 missense possibly damaging 0.89
R2081:Crybg2 UTSW 4 134088820 missense possibly damaging 0.82
R2229:Crybg2 UTSW 4 134074526 small deletion probably benign
R2392:Crybg2 UTSW 4 134072614 missense probably benign 0.01
R2939:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R2940:Crybg2 UTSW 4 134082434 missense possibly damaging 0.46
R3028:Crybg2 UTSW 4 134073784 missense probably benign 0.19
R4458:Crybg2 UTSW 4 134074894 missense probably benign 0.32
R4487:Crybg2 UTSW 4 134074201 missense probably benign 0.00
R4680:Crybg2 UTSW 4 134072718 frame shift probably null
R4681:Crybg2 UTSW 4 134072718 frame shift probably null
R4682:Crybg2 UTSW 4 134072718 frame shift probably null
R4766:Crybg2 UTSW 4 134089352 missense probably damaging 1.00
R5079:Crybg2 UTSW 4 134074253 missense possibly damaging 0.83
R5291:Crybg2 UTSW 4 134073427 missense probably benign 0.00
R5453:Crybg2 UTSW 4 134078836 critical splice acceptor site probably null
R5711:Crybg2 UTSW 4 134082627 missense probably damaging 0.97
R5834:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R5969:Crybg2 UTSW 4 134075692 splice site probably null
R5976:Crybg2 UTSW 4 134074526 small deletion probably benign
R6022:Crybg2 UTSW 4 134074273 nonsense probably null
R6046:Crybg2 UTSW 4 134092077 missense probably damaging 1.00
R6088:Crybg2 UTSW 4 134075790 unclassified probably null
R6196:Crybg2 UTSW 4 134081139 missense probably damaging 0.99
R6246:Crybg2 UTSW 4 134089346 missense probably damaging 0.96
R6303:Crybg2 UTSW 4 134087587 missense possibly damaging 0.66
R6320:Crybg2 UTSW 4 134081426 missense probably damaging 1.00
R6354:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R6737:Crybg2 UTSW 4 134072690 missense probably damaging 0.99
R6744:Crybg2 UTSW 4 134088896 missense probably damaging 1.00
R6847:Crybg2 UTSW 4 134065546 missense probably benign 0.40
R6891:Crybg2 UTSW 4 134081837 missense probably benign 0.32
R7043:Crybg2 UTSW 4 134091136 missense probably benign 0.39
R7133:Crybg2 UTSW 4 134065443 missense probably benign 0.09
R7166:Crybg2 UTSW 4 134060882 missense probably damaging 0.96
R7412:Crybg2 UTSW 4 134074123 missense probably benign 0.12
R7711:Crybg2 UTSW 4 134065533 missense probably benign 0.00
R7745:Crybg2 UTSW 4 134088845 missense possibly damaging 0.92
R7782:Crybg2 UTSW 4 134073826 missense probably benign 0.00
R7871:Crybg2 UTSW 4 134087599 missense probably damaging 1.00
R7954:Crybg2 UTSW 4 134087599 missense probably damaging 1.00
R8008:Crybg2 UTSW 4 134091104 missense probably damaging 1.00
X0064:Crybg2 UTSW 4 134089276 missense probably damaging 0.98
Z1176:Crybg2 UTSW 4 134082660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCTGAGGAGCATGGAGC -3'
(R):5'- TGTTGGCTGGCACCAGATTG -3'

Sequencing Primer
(F):5'- ATGGAGCCCCCTGAGATC -3'
(R):5'- GCCTTGTCCAGCTATGAGC -3'
Posted On2014-10-30