Incidental Mutation 'R2321:Abcf2'
ID245636
Institutional Source Beutler Lab
Gene Symbol Abcf2
Ensembl Gene ENSMUSG00000028953
Gene NameATP-binding cassette, sub-family F (GCN20), member 2
Synonyms0710005O05Rik, Drr3
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24565345-24577467 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 24567253 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 492 (Y492*)
Ref Sequence ENSEMBL: ENSMUSP00000030795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030795]
Predicted Effect probably null
Transcript: ENSMUST00000030795
AA Change: Y492*
SMART Domains Protein: ENSMUSP00000030795
Gene: ENSMUSG00000028953
AA Change: Y492*

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
AAA 115 308 1.6e-6 SMART
AAA 427 595 6.32e-5 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding casette proteins transport various molecules across extra- and intracellular membranes. Alterations in this gene may be involved in cancer progression. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 3 and 7. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Abcf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Abcf2 APN 5 24568796 missense possibly damaging 0.95
IGL02867:Abcf2 APN 5 24571151 missense probably benign 0.03
IGL03325:Abcf2 APN 5 24574212 missense probably damaging 1.00
IGL03329:Abcf2 APN 5 24571248 critical splice acceptor site probably null
R0281:Abcf2 UTSW 5 24566564 missense probably damaging 1.00
R0357:Abcf2 UTSW 5 24573465 missense probably benign 0.16
R0815:Abcf2 UTSW 5 24567270 missense probably damaging 1.00
R0835:Abcf2 UTSW 5 24574253 missense probably damaging 0.99
R1793:Abcf2 UTSW 5 24568776 missense probably benign
R5006:Abcf2 UTSW 5 24576537 nonsense probably null
R5765:Abcf2 UTSW 5 24573423 missense probably damaging 0.99
R6317:Abcf2 UTSW 5 24569158 nonsense probably null
R6684:Abcf2 UTSW 5 24569139 missense probably damaging 1.00
R6906:Abcf2 UTSW 5 24568842 missense possibly damaging 0.90
R6980:Abcf2 UTSW 5 24565972 missense probably benign 0.01
R8266:Abcf2 UTSW 5 24576591 small insertion probably benign
R8267:Abcf2 UTSW 5 24576591 small insertion probably benign
R8290:Abcf2 UTSW 5 24576591 small insertion probably benign
R8294:Abcf2 UTSW 5 24576591 small insertion probably benign
R8295:Abcf2 UTSW 5 24576591 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CAACCCCATTGTGCATGAC -3'
(R):5'- GGGAACACATCTGTCCAACC -3'

Sequencing Primer
(F):5'- TGCATGACACTACAGAGGAAAG -3'
(R):5'- TCCTCTGGGAACATAACCCC -3'
Posted On2014-10-30