Incidental Mutation 'R0279:Smtn'
ID24564
Institutional Source Beutler Lab
Gene Symbol Smtn
Ensembl Gene ENSMUSG00000020439
Gene Namesmoothelin
Synonyms
MMRRC Submission 038501-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R0279 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3517523-3540612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3530235 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 329 (V329L)
Ref Sequence ENSEMBL: ENSMUSP00000133155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020718] [ENSMUST00000020721] [ENSMUST00000075118] [ENSMUST00000110011] [ENSMUST00000136243] [ENSMUST00000156201] [ENSMUST00000170588]
Predicted Effect probably benign
Transcript: ENSMUST00000020718
SMART Domains Protein: ENSMUSP00000020718
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
coiled coil region 41 74 N/A INTRINSIC
low complexity region 75 100 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
Pfam:Smoothelin 154 208 1e-23 PFAM
low complexity region 212 236 N/A INTRINSIC
CH 322 421 1.04e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000020721
AA Change: V329L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020721
Gene: ENSMUSG00000020439
AA Change: V329L

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075118
AA Change: V329L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074621
Gene: ENSMUSG00000020439
AA Change: V329L

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.8e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 907 9.51e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110011
AA Change: V329L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105638
Gene: ENSMUSG00000020439
AA Change: V329L

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.5e-14 PFAM
Pfam:Smoothelin 72 122 8.5e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 568 617 6e-25 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 930 1.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128806
Predicted Effect probably benign
Transcript: ENSMUST00000136243
SMART Domains Protein: ENSMUSP00000117307
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.3e-16 PFAM
Pfam:Smoothelin 68 122 6.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154861
Predicted Effect probably benign
Transcript: ENSMUST00000156201
SMART Domains Protein: ENSMUSP00000118750
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 3.4e-13 PFAM
Pfam:Smoothelin 68 122 1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170588
AA Change: V329L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133155
Gene: ENSMUSG00000020439
AA Change: V329L

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Meta Mutation Damage Score 0.2712 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions of both the A and B isoforms of this gene display partial postnatal lethality, impaired intestinal smooth muscle contractility and thus hampered intestinal transit and diverticulosis. Mice lacking only the B isoform appearnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610528J11Rik A T 4: 118,529,293 M1L probably benign Het
5730596B20Rik T A 6: 52,179,202 probably benign Het
Acrbp T C 6: 125,053,954 probably null Het
Acss3 A G 10: 107,084,871 I126T possibly damaging Het
Aff3 T C 1: 38,535,569 E110G probably damaging Het
Aldh1a3 T C 7: 66,409,252 I113V probably benign Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Atp2b4 A G 1: 133,729,702 probably benign Het
Atp8a1 C T 5: 67,813,092 probably null Het
Bhmt A G 13: 93,625,464 C104R probably damaging Het
Ccdc151 A G 9: 21,990,247 probably benign Het
Cct5 T G 15: 31,591,031 E508A probably damaging Het
Celsr1 T A 15: 85,902,864 E2761D probably benign Het
Clstn1 T C 4: 149,643,674 S600P probably damaging Het
Cnppd1 A G 1: 75,136,929 S232P probably damaging Het
Crybb3 T C 5: 113,079,753 probably null Het
Csmd1 A G 8: 16,223,235 I861T probably damaging Het
Cyp2d10 A C 15: 82,405,339 S191A possibly damaging Het
Ddx10 T C 9: 53,235,304 D206G probably damaging Het
Dnah1 G T 14: 31,302,375 H916N possibly damaging Het
Dnah9 A G 11: 65,911,789 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Etnppl A G 3: 130,629,413 R248G probably damaging Het
Eya3 T C 4: 132,719,247 F369L probably damaging Het
Fam129a T C 1: 151,709,206 probably null Het
Fam170b T C 14: 32,834,068 probably benign Het
Fli1 A T 9: 32,461,427 V105D probably damaging Het
Fmo1 T C 1: 162,830,272 I433M possibly damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Foxe3 T C 4: 114,925,568 D149G probably damaging Het
Gk5 T C 9: 96,174,804 probably benign Het
Gm14226 A G 2: 155,025,452 D443G possibly damaging Het
Gm9796 C T 11: 95,697,995 noncoding transcript Het
Golga4 A T 9: 118,568,993 R52S probably benign Het
Hey2 C A 10: 30,834,010 C249F probably damaging Het
Ipo9 A T 1: 135,420,363 probably benign Het
Ireb2 C A 9: 54,886,593 T269K probably benign Het
Kansl3 A G 1: 36,351,969 V274A probably damaging Het
Kcnk2 C T 1: 189,209,972 A352T possibly damaging Het
Lamc2 T C 1: 153,130,696 E903G probably benign Het
Lepr A G 4: 101,750,344 K253R probably benign Het
Lmntd2 T C 7: 141,213,623 probably benign Het
Lrrc39 A T 3: 116,578,303 T240S probably benign Het
Lrrc43 A G 5: 123,497,022 probably null Het
Maf T C 8: 115,705,756 M370V possibly damaging Het
Mib2 G A 4: 155,661,216 S46L possibly damaging Het
Mms22l C T 4: 24,497,867 T63I probably damaging Het
Morc2a T A 11: 3,683,989 S700R probably benign Het
Mpz A G 1: 171,159,929 probably benign Het
Ncam2 T C 16: 81,623,337 probably benign Het
Nudt14 C T 12: 112,938,417 A123T probably damaging Het
Olfr1016 A T 2: 85,799,535 I245N possibly damaging Het
Olfr13 G A 6: 43,174,758 M257I probably benign Het
Olfr239 C T 17: 33,199,324 T92I probably benign Het
Otoa T C 7: 121,111,079 probably benign Het
Pik3cg G A 12: 32,204,791 T399I probably damaging Het
Pkn3 C T 2: 30,083,297 A377V probably benign Het
Ppan A G 9: 20,891,529 N327S probably benign Het
Prkca T C 11: 108,054,111 probably benign Het
Prrc2c A T 1: 162,715,464 V320E probably damaging Het
Ptprq A G 10: 107,608,417 V1442A probably damaging Het
Rapgef1 C T 2: 29,726,227 R834C probably damaging Het
Rbms1 G T 2: 60,842,410 N44K probably damaging Het
Rfwd3 A C 8: 111,282,733 F404V probably benign Het
Rimbp3 G T 16: 17,209,453 R247L probably benign Het
Serpinb1b T C 13: 33,093,713 S310P possibly damaging Het
Snapc2 T C 8: 4,254,979 probably benign Het
Spam1 A T 6: 24,800,419 M386L probably benign Het
Syne2 A G 12: 76,095,613 E6208G probably damaging Het
Teddm1a T C 1: 153,892,623 Y278H probably damaging Het
Tnfaip6 A T 2: 52,055,916 N258I possibly damaging Het
Trpm4 C T 7: 45,322,048 R188Q probably damaging Het
Ttbk2 A T 2: 120,748,960 H491Q probably benign Het
Urgcp C T 11: 5,716,989 E450K probably benign Het
Vmn1r228 T C 17: 20,776,375 N294D probably benign Het
Wdfy3 A T 5: 101,868,092 C2606S probably damaging Het
Wdr33 T A 18: 31,888,324 H642Q unknown Het
Zbtb46 A G 2: 181,411,774 S382P possibly damaging Het
Zfp217 A G 2: 170,119,780 I209T probably benign Het
Zranb3 T A 1: 127,963,773 N822I probably benign Het
Other mutations in Smtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Smtn APN 11 3526326 critical splice donor site probably null
IGL02335:Smtn APN 11 3526215 missense probably damaging 1.00
IGL02473:Smtn APN 11 3532463 missense probably damaging 1.00
IGL02678:Smtn APN 11 3526353 missense possibly damaging 0.95
IGL02824:Smtn APN 11 3532658 missense probably damaging 1.00
IGL03067:Smtn APN 11 3530165 missense possibly damaging 0.53
IGL03142:Smtn APN 11 3532601 nonsense probably null
runtish UTSW 11 3531326 missense possibly damaging 0.89
R0523:Smtn UTSW 11 3524664 missense possibly damaging 0.89
R0855:Smtn UTSW 11 3521880 missense probably damaging 1.00
R1080:Smtn UTSW 11 3517693 missense probably damaging 1.00
R1218:Smtn UTSW 11 3530021 missense probably benign
R1571:Smtn UTSW 11 3530102 missense probably benign 0.00
R1899:Smtn UTSW 11 3531326 missense possibly damaging 0.89
R2033:Smtn UTSW 11 3517781 missense probably benign 0.43
R2126:Smtn UTSW 11 3530045 missense probably benign 0.02
R2358:Smtn UTSW 11 3532865 splice site probably null
R3690:Smtn UTSW 11 3527687 intron probably benign
R3712:Smtn UTSW 11 3532865 splice site probably null
R4108:Smtn UTSW 11 3526449 missense probably benign 0.10
R4709:Smtn UTSW 11 3524663 missense probably damaging 0.99
R4710:Smtn UTSW 11 3524663 missense probably damaging 0.99
R4830:Smtn UTSW 11 3520736 intron probably benign
R4944:Smtn UTSW 11 3522916 missense probably damaging 1.00
R4959:Smtn UTSW 11 3527825 start codon destroyed probably null
R5223:Smtn UTSW 11 3529530 missense probably benign 0.00
R5554:Smtn UTSW 11 3520811 nonsense probably null
R5610:Smtn UTSW 11 3529582 missense probably damaging 1.00
R5636:Smtn UTSW 11 3517829 critical splice acceptor site probably null
R5972:Smtn UTSW 11 3533486 missense probably damaging 1.00
R6108:Smtn UTSW 11 3529608 missense probably damaging 0.99
R6227:Smtn UTSW 11 3527624 intron probably benign
R7016:Smtn UTSW 11 3530368 critical splice donor site probably null
R7423:Smtn UTSW 11 3531200 critical splice donor site probably null
R7426:Smtn UTSW 11 3530249 missense probably benign 0.10
R7447:Smtn UTSW 11 3530196 missense probably benign
R7496:Smtn UTSW 11 3529988 missense probably damaging 0.99
R7716:Smtn UTSW 11 3524708 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAAGTTCTCTCTGCTTCTTGTGG -3'
(R):5'- GTCTGAAACGAAATCCTGCCAACG -3'

Sequencing Primer
(F):5'- GGAAGTGTCACTGGGACTC -3'
(R):5'- AACGTTCACTATCTGTGCTCAG -3'
Posted On2013-04-16