Incidental Mutation 'R2321:Serpinh1'
ID245641
Institutional Source Beutler Lab
Gene Symbol Serpinh1
Ensembl Gene ENSMUSG00000070436
Gene Nameserine (or cysteine) peptidase inhibitor, clade H, member 1
SynonymsHsp47, gp46, Cbp2, Serpinh2, Cbp1, colligin, J6
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99345376-99353239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99346385 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 330 (D330G)
Ref Sequence ENSEMBL: ENSMUSP00000146969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094154] [ENSMUST00000169437] [ENSMUST00000207849] [ENSMUST00000207989] [ENSMUST00000208119] [ENSMUST00000208292] [ENSMUST00000208749]
Predicted Effect probably damaging
Transcript: ENSMUST00000094154
AA Change: D330G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091706
Gene: ENSMUSG00000070436
AA Change: D330G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 51 408 6.88e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169437
AA Change: D330G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126390
Gene: ENSMUSG00000070436
AA Change: D330G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 51 408 6.88e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207849
AA Change: D330G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207989
Predicted Effect probably damaging
Transcript: ENSMUST00000208119
AA Change: D330G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208292
Predicted Effect probably benign
Transcript: ENSMUST00000208749
Meta Mutation Damage Score 0.3188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E11.5. Mice homozygous for a conditional allele activated in chondrocytes exhibit complete perinatal lethality, cleft palate, respiratory distress, abnormal chondocytes and bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Serpinh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02405:Serpinh1 APN 7 99347334 missense possibly damaging 0.94
IGL02506:Serpinh1 APN 7 99346992 missense probably damaging 1.00
R0070:Serpinh1 UTSW 7 99349314 missense probably damaging 1.00
R0070:Serpinh1 UTSW 7 99349314 missense probably damaging 1.00
R0608:Serpinh1 UTSW 7 99349394 missense unknown
R1338:Serpinh1 UTSW 7 99348911 missense probably damaging 1.00
R1612:Serpinh1 UTSW 7 99348931 missense probably damaging 0.97
R1916:Serpinh1 UTSW 7 99349081 missense probably damaging 1.00
R2886:Serpinh1 UTSW 7 99349021 missense probably damaging 1.00
R4176:Serpinh1 UTSW 7 99346999 missense probably benign
R5860:Serpinh1 UTSW 7 99346364 missense probably damaging 1.00
R7345:Serpinh1 UTSW 7 99346356 missense probably damaging 0.99
R7884:Serpinh1 UTSW 7 99349288 missense probably benign 0.00
R7967:Serpinh1 UTSW 7 99349288 missense probably benign 0.00
RF005:Serpinh1 UTSW 7 99346203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGCTCTGATTATCTCGC -3'
(R):5'- CCTGGTGGTATACAGAGGAAC -3'

Sequencing Primer
(F):5'- CTGATTATCTCGCACCAGGAAGATG -3'
(R):5'- CAAAAGGAACAGTGGTTTGCAGC -3'
Posted On2014-10-30