Incidental Mutation 'R2321:Dcaf1'
ID245645
Institutional Source Beutler Lab
Gene Symbol Dcaf1
Ensembl Gene ENSMUSG00000040325
Gene NameDDB1 and CUL4 associated factor 1
SynonymsB930007L02Rik, Vprbp
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106821874-106880992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106838473 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 263 (L263S)
Ref Sequence ENSEMBL: ENSMUSP00000125730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055009] [ENSMUST00000159645] [ENSMUST00000161758]
Predicted Effect probably benign
Transcript: ENSMUST00000055009
AA Change: L263S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000060025
Gene: ENSMUSG00000040325
AA Change: L263S

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1392 N/A PDB
SCOP:d1tbga_ 1063 1375 9e-20 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1393 1452 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
PDB:4P7I|D 1484 1506 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000159620
SMART Domains Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 18 120 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159645
AA Change: L263S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123865
Gene: ENSMUSG00000040325
AA Change: L263S

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1394 N/A PDB
SCOP:d1tbga_ 1063 1375 1e-19 SMART
Blast:WD40 1078 1120 2e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1395 1402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161758
AA Change: L263S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125730
Gene: ENSMUSG00000040325
AA Change: L263S

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1398 N/A PDB
SCOP:d1tbga_ 1063 1308 3e-19 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1399 1458 N/A INTRINSIC
low complexity region 1463 1489 N/A INTRINSIC
PDB:4P7I|D 1490 1512 2e-6 PDB
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-out allele die prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Dcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Dcaf1 APN 9 106858333 missense probably benign 0.45
IGL01314:Dcaf1 APN 9 106834191 missense probably benign 0.07
IGL01395:Dcaf1 APN 9 106858162 missense possibly damaging 0.73
IGL01936:Dcaf1 APN 9 106859601 missense possibly damaging 0.81
IGL02089:Dcaf1 APN 9 106863111 missense probably benign 0.40
IGL02596:Dcaf1 APN 9 106863021 missense probably damaging 1.00
IGL02828:Dcaf1 APN 9 106844302 splice site probably benign
IGL03036:Dcaf1 APN 9 106844140 missense probably damaging 1.00
IGL03327:Dcaf1 APN 9 106858624 missense possibly damaging 0.79
Latte UTSW 9 106846772 nonsense probably null
IGL02799:Dcaf1 UTSW 9 106857940 missense probably benign 0.42
P0023:Dcaf1 UTSW 9 106860451 missense probably benign 0.40
R0087:Dcaf1 UTSW 9 106863089 missense probably damaging 1.00
R0164:Dcaf1 UTSW 9 106844145 missense possibly damaging 0.94
R0164:Dcaf1 UTSW 9 106844145 missense possibly damaging 0.94
R0562:Dcaf1 UTSW 9 106844122 splice site probably benign
R0690:Dcaf1 UTSW 9 106846649 splice site probably benign
R1373:Dcaf1 UTSW 9 106857880 missense probably benign 0.18
R1508:Dcaf1 UTSW 9 106854177 missense probably damaging 1.00
R1765:Dcaf1 UTSW 9 106864594 missense probably damaging 1.00
R1845:Dcaf1 UTSW 9 106851962 missense probably benign 0.01
R2016:Dcaf1 UTSW 9 106839088 missense probably benign 0.41
R2017:Dcaf1 UTSW 9 106839088 missense probably benign 0.41
R2017:Dcaf1 UTSW 9 106847923 missense probably damaging 0.99
R2246:Dcaf1 UTSW 9 106854177 missense possibly damaging 0.94
R4528:Dcaf1 UTSW 9 106844204 missense probably damaging 1.00
R4646:Dcaf1 UTSW 9 106846807 missense probably benign 0.27
R4648:Dcaf1 UTSW 9 106865677 unclassified probably benign
R4742:Dcaf1 UTSW 9 106858555 missense probably benign 0.00
R5876:Dcaf1 UTSW 9 106863650 missense probably damaging 1.00
R5926:Dcaf1 UTSW 9 106838362 missense probably benign 0.02
R6057:Dcaf1 UTSW 9 106854247 missense probably damaging 0.99
R6335:Dcaf1 UTSW 9 106838646 missense possibly damaging 0.63
R6518:Dcaf1 UTSW 9 106835589 missense probably damaging 1.00
R6812:Dcaf1 UTSW 9 106858069 missense probably damaging 1.00
R6829:Dcaf1 UTSW 9 106838604 missense probably damaging 0.97
R6972:Dcaf1 UTSW 9 106846772 nonsense probably null
R7175:Dcaf1 UTSW 9 106858576 missense probably benign 0.32
R7650:Dcaf1 UTSW 9 106838344 missense probably benign 0.01
R7734:Dcaf1 UTSW 9 106838679 missense probably damaging 1.00
X0019:Dcaf1 UTSW 9 106834159 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCCTTTTGCCTCTGGATGAG -3'
(R):5'- TACTCTCCTAAAGGGGTCAAATACTG -3'

Sequencing Primer
(F):5'- CTCTGGATGAGGAAGCTGTG -3'
(R):5'- GAAGAATAAGTCTCTGCTCAATAGC -3'
Posted On2014-10-30