Incidental Mutation 'R2321:Slc22a13'
ID245646
Institutional Source Beutler Lab
Gene Symbol Slc22a13
Ensembl Gene ENSMUSG00000074028
Gene Namesolute carrier family 22 (organic cation transporter), member 13
SynonymsOCTL1, ORCTL3, OCTL3
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119192974-119209098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119195628 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 261 (V261D)
Ref Sequence ENSEMBL: ENSMUSP00000081855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084797] [ENSMUST00000170400]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084797
AA Change: V261D

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081855
Gene: ENSMUSG00000074028
AA Change: V261D

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 104 514 2.2e-41 PFAM
Pfam:MFS_1 133 468 2.6e-26 PFAM
Pfam:MFS_1 355 537 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 4. The encoded protein is a transmembrane protein involved in the transport of small molecules. This protein can function to mediate urate uptake and is a high affinity nicotinate exchanger in the kidneys and the intestine. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Slc22a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02828:Slc22a13 APN 9 119195707 missense probably benign 0.25
IGL02871:Slc22a13 APN 9 119196011 missense probably benign 0.01
R0764:Slc22a13 UTSW 9 119208680 splice site probably null
R1469:Slc22a13 UTSW 9 119193295 missense possibly damaging 0.67
R1469:Slc22a13 UTSW 9 119193295 missense possibly damaging 0.67
R1545:Slc22a13 UTSW 9 119209047 missense probably benign 0.00
R2154:Slc22a13 UTSW 9 119208687 missense probably benign 0.00
R3808:Slc22a13 UTSW 9 119196077 missense probably benign
R3840:Slc22a13 UTSW 9 119208789 missense probably benign 0.18
R4736:Slc22a13 UTSW 9 119193632 missense probably damaging 1.00
R6286:Slc22a13 UTSW 9 119208712 nonsense probably null
R6899:Slc22a13 UTSW 9 119196407 missense probably damaging 1.00
R7579:Slc22a13 UTSW 9 119195160 missense possibly damaging 0.62
Z1177:Slc22a13 UTSW 9 119193304 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGATTCTGGCAGAACCCTGTC -3'
(R):5'- TTTGGGAAACTGCCAGAAGG -3'

Sequencing Primer
(F):5'- GAACCCTGTCAACCACGCATG -3'
(R):5'- AGTGAGGAGATGAGATCCAGTC -3'
Posted On2014-10-30