Incidental Mutation 'R2321:Krtap17-1'
ID245649
Institutional Source Beutler Lab
Gene Symbol Krtap17-1
Ensembl Gene ENSMUSG00000078252
Gene Namekeratin associated protein 17-1
Synonyms
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2321 (G1)
Quality Score162
Status Validated
Chromosome11
Chromosomal Location99993234-99993994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99993920 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 7 (D7G)
Ref Sequence ENSEMBL: ENSMUSP00000100670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105049]
Predicted Effect unknown
Transcript: ENSMUST00000105049
AA Change: D7G
SMART Domains Protein: ENSMUSP00000100670
Gene: ENSMUSG00000078252
AA Change: D7G

DomainStartEndE-ValueType
low complexity region 18 96 N/A INTRINSIC
Meta Mutation Damage Score 0.0810 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Krtap17-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
ginny UTSW 11 99993655 nonsense probably null
R3751:Krtap17-1 UTSW 11 99993655 nonsense probably null
R4212:Krtap17-1 UTSW 11 99993914 missense unknown
R4213:Krtap17-1 UTSW 11 99993914 missense unknown
R5915:Krtap17-1 UTSW 11 99993618 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAGGTCTTCATTTTGTCTCACAC -3'
(R):5'- AGACGTTCTTATGGAAACCAGC -3'

Sequencing Primer
(F):5'- GATCCGCAGCAGCTAGAC -3'
(R):5'- GGAAACCAGCACAAATAATAACAAAG -3'
Posted On2014-10-30