Incidental Mutation 'R2321:Rnps1'
ID245660
Institutional Source Beutler Lab
Gene Symbol Rnps1
Ensembl Gene ENSMUSG00000034681
Gene Nameribonucleic acid binding protein S1
Synonyms
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24414675-24425895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24422168 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 181 (F181I)
Ref Sequence ENSEMBL: ENSMUSP00000126345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024946] [ENSMUST00000088512] [ENSMUST00000115371] [ENSMUST00000163717]
Predicted Effect probably benign
Transcript: ENSMUST00000024946
SMART Domains Protein: ENSMUSP00000024946
Gene: ENSMUSG00000024132

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:ECH_1 39 288 3.2e-96 PFAM
Pfam:ECH_2 44 289 5.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088512
AA Change: F181I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085867
Gene: ENSMUSG00000034681
AA Change: F181I

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 55 157 N/A INTRINSIC
RRM 162 236 5.12e-21 SMART
low complexity region 243 305 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115371
AA Change: F158I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111028
Gene: ENSMUSG00000034681
AA Change: F158I

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 32 134 N/A INTRINSIC
RRM 139 213 5.12e-21 SMART
low complexity region 220 282 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163717
AA Change: F181I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126345
Gene: ENSMUSG00000034681
AA Change: F181I

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 55 157 N/A INTRINSIC
RRM 162 236 5.12e-21 SMART
low complexity region 243 305 N/A INTRINSIC
Meta Mutation Damage Score 0.9699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. This protein contains many serine residues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Rnps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Rnps1 APN 17 24422299 missense probably damaging 1.00
IGL01433:Rnps1 APN 17 24424545 critical splice donor site probably null
IGL01984:Rnps1 APN 17 24424397 splice site probably benign
IGL03410:Rnps1 APN 17 24421861 splice site probably benign
unbalanced UTSW 17 24422168 missense probably damaging 1.00
R0594:Rnps1 UTSW 17 24424437 missense probably damaging 0.99
R1397:Rnps1 UTSW 17 24412057 unclassified probably benign
R1938:Rnps1 UTSW 17 24420390 missense unknown
R3085:Rnps1 UTSW 17 24412419 unclassified probably benign
R3086:Rnps1 UTSW 17 24412419 unclassified probably benign
R4296:Rnps1 UTSW 17 24425115 unclassified probably benign
R5159:Rnps1 UTSW 17 24418512 missense unknown
R5193:Rnps1 UTSW 17 24418543 missense probably benign 0.23
R5753:Rnps1 UTSW 17 24418164 intron probably benign
R7378:Rnps1 UTSW 17 24418530 missense unknown
R7403:Rnps1 UTSW 17 24425087 missense unknown
R7690:Rnps1 UTSW 17 24418194 missense unknown
R8104:Rnps1 UTSW 17 24424510 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGTGACTTGATCAGAATGCTGC -3'
(R):5'- TACTTCAGGGTCCCCAAAAC -3'

Sequencing Primer
(F):5'- GGCATATTACCAGGTGAC -3'
(R):5'- CTCTCCAAGGAAGGACAGAGGTG -3'
Posted On2014-10-30