Incidental Mutation 'R2321:Men1'
ID245661
Institutional Source Beutler Lab
Gene Symbol Men1
Ensembl Gene ENSMUSG00000024947
Gene Namemultiple endocrine neoplasia 1
Synonymsmenin
MMRRC Submission 040313-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6334979-6340891 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6339838 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 466 (D466G)
Ref Sequence ENSEMBL: ENSMUSP00000109129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000056391] [ENSMUST00000078137] [ENSMUST00000079327] [ENSMUST00000113500] [ENSMUST00000113501] [ENSMUST00000113502] [ENSMUST00000113503] [ENSMUST00000113504] [ENSMUST00000124556] [ENSMUST00000130382] [ENSMUST00000142496] [ENSMUST00000152349] [ENSMUST00000166909] [ENSMUST00000170132]
Predicted Effect probably benign
Transcript: ENSMUST00000025897
SMART Domains Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 273 2.41e-90 SMART
low complexity region 358 369 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
CNH 488 801 1.31e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056391
AA Change: D501G

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000058149
Gene: ENSMUSG00000024947
AA Change: D501G

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078137
AA Change: D446G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077272
Gene: ENSMUSG00000024947
AA Change: D446G

DomainStartEndE-ValueType
Pfam:Menin 1 396 2.6e-241 PFAM
Pfam:Menin 392 556 1.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079327
AA Change: D501G

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000078306
Gene: ENSMUSG00000024947
AA Change: D501G

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113500
AA Change: D501G

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109128
Gene: ENSMUSG00000024947
AA Change: D501G

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113501
AA Change: D466G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109129
Gene: ENSMUSG00000024947
AA Change: D466G

DomainStartEndE-ValueType
Pfam:Menin 1 183 2.6e-104 PFAM
Pfam:Menin 184 576 3.2e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113502
AA Change: D507G

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109130
Gene: ENSMUSG00000024947
AA Change: D507G

DomainStartEndE-ValueType
Pfam:Menin 7 515 1.5e-254 PFAM
Pfam:Menin 536 615 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113503
AA Change: D506G

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109131
Gene: ENSMUSG00000024947
AA Change: D506G

DomainStartEndE-ValueType
Pfam:Menin 1 616 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113504
AA Change: D501G

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109132
Gene: ENSMUSG00000024947
AA Change: D501G

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124333
Predicted Effect probably benign
Transcript: ENSMUST00000124556
SMART Domains Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127809
Predicted Effect probably benign
Transcript: ENSMUST00000130382
SMART Domains Protein: ENSMUSP00000120123
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 233 3.4e-14 SMART
low complexity region 314 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134307
Predicted Effect probably benign
Transcript: ENSMUST00000142496
SMART Domains Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152259
Predicted Effect probably benign
Transcript: ENSMUST00000152349
SMART Domains Protein: ENSMUSP00000115741
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 57 3.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156154
Predicted Effect probably benign
Transcript: ENSMUST00000166909
SMART Domains Protein: ENSMUSP00000133085
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 62 8.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170132
SMART Domains Protein: ENSMUSP00000126655
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 135 1.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170292
SMART Domains Protein: ENSMUSP00000128607
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 4 106 1.2e-28 PFAM
Meta Mutation Damage Score 0.1206 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes menin, a putative tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. In vitro studies have shown menin is localized to the nucleus, possesses two functional nuclear localization signals, and inhibits transcriptional activation by JunD, however, the function of this protein is not known. Two messages have been detected on northern blots but the larger message has not been characterized. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-13.5 with reduced size, edema, open neural tube and defects of the nervous system, heart and liver. Heterozygotes develop tumors of the pancreas, parathyroid, thyroid, adrenal and pituitary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Wdr64 A C 1: 175,795,087 K810T possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Men1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Men1 APN 19 6337207 intron probably null
IGL00160:Men1 APN 19 6337207 intron probably null
IGL00161:Men1 APN 19 6337207 intron probably null
IGL00229:Men1 APN 19 6337207 intron probably null
IGL00231:Men1 APN 19 6337207 intron probably null
IGL00232:Men1 APN 19 6337207 intron probably null
IGL00434:Men1 APN 19 6337207 intron probably null
IGL00467:Men1 APN 19 6337207 intron probably null
IGL00468:Men1 APN 19 6337207 intron probably null
IGL00470:Men1 APN 19 6337207 intron probably null
IGL00476:Men1 APN 19 6337207 intron probably null
IGL02305:Men1 APN 19 6340138 missense probably damaging 1.00
R0468:Men1 UTSW 19 6336923 missense probably null 0.99
R0856:Men1 UTSW 19 6335858 missense probably damaging 1.00
R1384:Men1 UTSW 19 6339891 missense probably benign 0.12
R1870:Men1 UTSW 19 6337630 missense probably damaging 1.00
R1987:Men1 UTSW 19 6338837 missense probably damaging 0.99
R4538:Men1 UTSW 19 6336754 missense possibly damaging 0.89
R4763:Men1 UTSW 19 6335072 critical splice donor site probably null
R6147:Men1 UTSW 19 6337242 missense probably damaging 0.97
R7598:Men1 UTSW 19 6339705 missense probably benign 0.06
R7726:Men1 UTSW 19 6337282 critical splice donor site probably null
RF002:Men1 UTSW 19 6340116 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAGAGGTCCCACGGATGATC -3'
(R):5'- CACCAGTAGCTCCTTCATGC -3'

Sequencing Primer
(F):5'- TCCCACGGATGATCCTCAG -3'
(R):5'- GCCTTTCATCTTCTCACTCTGGAAAG -3'
Posted On2014-10-30