Incidental Mutation 'R2327:Fastkd1'
ID 245669
Institutional Source Beutler Lab
Gene Symbol Fastkd1
Ensembl Gene ENSMUSG00000027086
Gene Name FAST kinase domains 1
Synonyms 5330408N05Rik
MMRRC Submission 040318-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R2327 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 69517159-69543860 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 69535872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 312 (K312*)
Ref Sequence ENSEMBL: ENSMUSP00000099767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073152] [ENSMUST00000102706]
AlphaFold Q6DI86
Predicted Effect probably null
Transcript: ENSMUST00000073152
AA Change: K312*
SMART Domains Protein: ENSMUSP00000072896
Gene: ENSMUSG00000027086
AA Change: K312*

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 560 628 6.6e-25 PFAM
Pfam:FAST_2 645 730 6.4e-26 PFAM
RAP 763 822 4.38e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102706
AA Change: K312*
SMART Domains Protein: ENSMUSP00000099767
Gene: ENSMUSG00000027086
AA Change: K312*

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 530 600 2.2e-26 PFAM
Pfam:FAST_2 614 701 4.4e-31 PFAM
RAP 734 793 4.38e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140776
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 64,208,569 (GRCm39) probably null Het
Agbl4 T G 4: 111,383,798 (GRCm39) S218A probably benign Het
Apol11b T C 15: 77,522,153 (GRCm39) E48G probably damaging Het
Atp4a T A 7: 30,419,666 (GRCm39) N676K probably benign Het
Capn5 T A 7: 97,775,574 (GRCm39) S456C probably benign Het
Ccar1 T C 10: 62,600,161 (GRCm39) Y590C probably damaging Het
Ccdc188 G T 16: 18,037,070 (GRCm39) G283W probably damaging Het
Cd69 A G 6: 129,248,351 (GRCm39) V45A probably damaging Het
Col3a1 G T 1: 45,377,771 (GRCm39) probably benign Het
Cyb561a3 A T 19: 10,564,166 (GRCm39) T169S probably benign Het
Cyp2c39 A T 19: 39,527,397 (GRCm39) I248L probably benign Het
Cyp2j13 T C 4: 95,947,344 (GRCm39) T236A possibly damaging Het
Efs A G 14: 55,154,961 (GRCm39) V426A probably benign Het
Eme2 A G 17: 25,113,157 (GRCm39) L136S probably damaging Het
Fbxl12 A G 9: 20,553,530 (GRCm39) L19P probably damaging Het
Flg2 T A 3: 93,110,913 (GRCm39) Y980* probably null Het
Fscn2 T A 11: 120,257,527 (GRCm39) I296N probably damaging Het
Gabrg3 A G 7: 56,384,835 (GRCm39) V242A probably benign Het
Galk2 A G 2: 125,817,315 (GRCm39) H368R probably damaging Het
Gm12695 C T 4: 96,657,893 (GRCm39) S92N probably benign Het
Gpalpp1 A T 14: 76,336,031 (GRCm39) S196T probably benign Het
Gpld1 A T 13: 25,168,804 (GRCm39) M773L probably benign Het
Haus8 A G 8: 71,708,289 (GRCm39) probably null Het
Hirip3 A G 7: 126,462,038 (GRCm39) R19G probably damaging Het
Inpp4a A G 1: 37,405,247 (GRCm39) T92A probably damaging Het
Irgm2 A G 11: 58,111,218 (GRCm39) D303G probably damaging Het
Kpna2rt C A 17: 90,217,697 (GRCm39) R16S probably benign Het
Krtap5-2 T G 7: 141,728,748 (GRCm39) S311R unknown Het
Krtdap T A 7: 30,489,185 (GRCm39) probably null Het
Lce1g G T 3: 92,658,140 (GRCm39) S56Y unknown Het
Lrrn1 G A 6: 107,545,794 (GRCm39) V531I probably benign Het
Mctp2 T C 7: 71,861,358 (GRCm39) E429G probably damaging Het
Mrgpra2b T G 7: 47,113,793 (GRCm39) D287A probably damaging Het
Mterf3 T C 13: 67,076,258 (GRCm39) T150A probably damaging Het
Mtus2 A G 5: 148,014,725 (GRCm39) N506S probably benign Het
Myh15 G T 16: 48,963,313 (GRCm39) V1085L probably benign Het
Myo9a A G 9: 59,687,048 (GRCm39) N51S probably benign Het
Nlrc3 A T 16: 3,771,304 (GRCm39) L196Q probably damaging Het
Nlrp9c T A 7: 26,074,747 (GRCm39) N816I probably damaging Het
Nsun2 T C 13: 69,767,700 (GRCm39) V218A probably benign Het
Nt5dc1 T C 10: 34,189,673 (GRCm39) E339G possibly damaging Het
Or10ak14 C T 4: 118,611,331 (GRCm39) V135I probably benign Het
Or51b6b A G 7: 103,309,779 (GRCm39) V226A probably damaging Het
Or8j3c A T 2: 86,253,165 (GRCm39) L285* probably null Het
Pik3ap1 A G 19: 41,284,828 (GRCm39) I619T probably damaging Het
Plk1 A G 7: 121,759,118 (GRCm39) D118G probably benign Het
Ppat T C 5: 77,070,314 (GRCm39) D168G possibly damaging Het
Preb T C 5: 31,115,849 (GRCm39) E198G probably damaging Het
Psg21 T C 7: 18,386,378 (GRCm39) T203A possibly damaging Het
Rbm17 A G 2: 11,602,942 (GRCm39) V54A probably damaging Het
Rgma T A 7: 73,067,574 (GRCm39) D276E probably damaging Het
Ric8a T C 7: 140,439,471 (GRCm39) L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scarf1 A C 11: 75,416,854 (GRCm39) E765D probably damaging Het
Scart1 A T 7: 139,803,890 (GRCm39) N363Y possibly damaging Het
Sec14l4 G A 11: 3,990,041 (GRCm39) M113I probably benign Het
Senp1 C T 15: 97,980,165 (GRCm39) C60Y probably damaging Het
Slc22a21 T A 11: 53,842,130 (GRCm39) K549N probably benign Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Spata13 T C 14: 60,947,004 (GRCm39) M684T probably damaging Het
Spns1 T C 7: 125,969,958 (GRCm39) T481A probably damaging Het
Stag1 A G 9: 100,668,666 (GRCm39) Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 (GRCm39) V210E probably damaging Het
Tnc C T 4: 63,893,475 (GRCm39) E1604K possibly damaging Het
Tspan31 T C 10: 126,904,365 (GRCm39) D143G probably benign Het
Tspan5 T A 3: 138,603,903 (GRCm39) Y131* probably null Het
Ttc21a A G 9: 119,795,189 (GRCm39) D1070G probably damaging Het
Vmn2r26 C T 6: 124,016,708 (GRCm39) P391S probably benign Het
Vmn2r72 A G 7: 85,387,464 (GRCm39) I700T probably damaging Het
Vps13c A C 9: 67,821,102 (GRCm39) N1204T probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Fastkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fastkd1 APN 2 69,537,893 (GRCm39) missense probably benign 0.02
IGL00702:Fastkd1 APN 2 69,538,889 (GRCm39) missense probably damaging 0.99
IGL00960:Fastkd1 APN 2 69,524,997 (GRCm39) splice site probably benign
IGL01154:Fastkd1 APN 2 69,520,404 (GRCm39) splice site probably null
IGL01463:Fastkd1 APN 2 69,520,405 (GRCm39) critical splice donor site probably null
IGL01913:Fastkd1 APN 2 69,538,845 (GRCm39) splice site probably benign
IGL01977:Fastkd1 APN 2 69,524,932 (GRCm39) missense possibly damaging 0.64
IGL02408:Fastkd1 APN 2 69,532,945 (GRCm39) missense probably benign
IGL02715:Fastkd1 APN 2 69,542,469 (GRCm39) critical splice donor site probably null
IGL03411:Fastkd1 APN 2 69,537,703 (GRCm39) missense probably damaging 0.99
PIT4519001:Fastkd1 UTSW 2 69,520,501 (GRCm39) missense probably damaging 0.97
R0541:Fastkd1 UTSW 2 69,532,750 (GRCm39) missense probably damaging 1.00
R0612:Fastkd1 UTSW 2 69,542,727 (GRCm39) missense probably benign 0.03
R1170:Fastkd1 UTSW 2 69,538,993 (GRCm39) splice site probably benign
R1499:Fastkd1 UTSW 2 69,538,982 (GRCm39) critical splice acceptor site probably null
R1586:Fastkd1 UTSW 2 69,542,492 (GRCm39) missense probably benign 0.43
R1698:Fastkd1 UTSW 2 69,532,813 (GRCm39) missense probably benign 0.22
R2172:Fastkd1 UTSW 2 69,530,477 (GRCm39) missense probably damaging 1.00
R2240:Fastkd1 UTSW 2 69,527,297 (GRCm39) missense probably benign 0.01
R2897:Fastkd1 UTSW 2 69,532,960 (GRCm39) missense probably damaging 1.00
R4120:Fastkd1 UTSW 2 69,537,654 (GRCm39) missense probably damaging 0.98
R4544:Fastkd1 UTSW 2 69,542,655 (GRCm39) missense probably damaging 1.00
R4546:Fastkd1 UTSW 2 69,542,655 (GRCm39) missense probably damaging 1.00
R4798:Fastkd1 UTSW 2 69,521,651 (GRCm39) missense probably benign 0.38
R4993:Fastkd1 UTSW 2 69,533,084 (GRCm39) missense probably damaging 0.99
R5284:Fastkd1 UTSW 2 69,542,532 (GRCm39) missense probably benign 0.01
R5668:Fastkd1 UTSW 2 69,537,725 (GRCm39) missense possibly damaging 0.92
R6869:Fastkd1 UTSW 2 69,533,104 (GRCm39) missense probably benign 0.02
R6870:Fastkd1 UTSW 2 69,538,958 (GRCm39) missense probably benign 0.05
R7062:Fastkd1 UTSW 2 69,534,666 (GRCm39) missense possibly damaging 0.74
R7576:Fastkd1 UTSW 2 69,524,988 (GRCm39) missense probably damaging 1.00
R7644:Fastkd1 UTSW 2 69,527,184 (GRCm39) splice site probably null
R7971:Fastkd1 UTSW 2 69,537,703 (GRCm39) missense probably benign 0.19
R8336:Fastkd1 UTSW 2 69,542,489 (GRCm39) missense probably damaging 1.00
R8403:Fastkd1 UTSW 2 69,517,425 (GRCm39) nonsense probably null
R8422:Fastkd1 UTSW 2 69,532,778 (GRCm39) missense probably damaging 1.00
R9041:Fastkd1 UTSW 2 69,532,715 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTTCTGAAACCCCAAACG -3'
(R):5'- CTGTAGTAATCTGTAGAAAACCGAGAG -3'

Sequencing Primer
(F):5'- TCAAACATGAAGTACTTCCGTCAG -3'
(R):5'- CGAGAGGAGCTCTTCTTCCC -3'
Posted On 2014-10-30