Incidental Mutation 'R2327:Or8j3c'
ID 245670
Institutional Source Beutler Lab
Gene Symbol Or8j3c
Ensembl Gene ENSMUSG00000090059
Gene Name olfactory receptor family 8 subfamily J member 3C
Synonyms GA_x6K02T2Q125-47892992-47892045, Olfr1062, MOR185-1
MMRRC Submission 040318-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R2327 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 86253063-86254018 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 86253165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 285 (L285*)
Ref Sequence ENSEMBL: ENSMUSP00000149742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105213] [ENSMUST00000217481]
AlphaFold Q7TR71
Predicted Effect probably null
Transcript: ENSMUST00000105213
AA Change: L285*
SMART Domains Protein: ENSMUSP00000100848
Gene: ENSMUSG00000090059
AA Change: L285*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-46 PFAM
Pfam:7tm_1 41 290 2.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216166
Predicted Effect probably null
Transcript: ENSMUST00000217481
AA Change: L285*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 64,208,569 (GRCm39) probably null Het
Agbl4 T G 4: 111,383,798 (GRCm39) S218A probably benign Het
Apol11b T C 15: 77,522,153 (GRCm39) E48G probably damaging Het
Atp4a T A 7: 30,419,666 (GRCm39) N676K probably benign Het
Capn5 T A 7: 97,775,574 (GRCm39) S456C probably benign Het
Ccar1 T C 10: 62,600,161 (GRCm39) Y590C probably damaging Het
Ccdc188 G T 16: 18,037,070 (GRCm39) G283W probably damaging Het
Cd69 A G 6: 129,248,351 (GRCm39) V45A probably damaging Het
Col3a1 G T 1: 45,377,771 (GRCm39) probably benign Het
Cyb561a3 A T 19: 10,564,166 (GRCm39) T169S probably benign Het
Cyp2c39 A T 19: 39,527,397 (GRCm39) I248L probably benign Het
Cyp2j13 T C 4: 95,947,344 (GRCm39) T236A possibly damaging Het
Efs A G 14: 55,154,961 (GRCm39) V426A probably benign Het
Eme2 A G 17: 25,113,157 (GRCm39) L136S probably damaging Het
Fastkd1 T A 2: 69,535,872 (GRCm39) K312* probably null Het
Fbxl12 A G 9: 20,553,530 (GRCm39) L19P probably damaging Het
Flg2 T A 3: 93,110,913 (GRCm39) Y980* probably null Het
Fscn2 T A 11: 120,257,527 (GRCm39) I296N probably damaging Het
Gabrg3 A G 7: 56,384,835 (GRCm39) V242A probably benign Het
Galk2 A G 2: 125,817,315 (GRCm39) H368R probably damaging Het
Gm12695 C T 4: 96,657,893 (GRCm39) S92N probably benign Het
Gpalpp1 A T 14: 76,336,031 (GRCm39) S196T probably benign Het
Gpld1 A T 13: 25,168,804 (GRCm39) M773L probably benign Het
Haus8 A G 8: 71,708,289 (GRCm39) probably null Het
Hirip3 A G 7: 126,462,038 (GRCm39) R19G probably damaging Het
Inpp4a A G 1: 37,405,247 (GRCm39) T92A probably damaging Het
Irgm2 A G 11: 58,111,218 (GRCm39) D303G probably damaging Het
Kpna2rt C A 17: 90,217,697 (GRCm39) R16S probably benign Het
Krtap5-2 T G 7: 141,728,748 (GRCm39) S311R unknown Het
Krtdap T A 7: 30,489,185 (GRCm39) probably null Het
Lce1g G T 3: 92,658,140 (GRCm39) S56Y unknown Het
Lrrn1 G A 6: 107,545,794 (GRCm39) V531I probably benign Het
Mctp2 T C 7: 71,861,358 (GRCm39) E429G probably damaging Het
Mrgpra2b T G 7: 47,113,793 (GRCm39) D287A probably damaging Het
Mterf3 T C 13: 67,076,258 (GRCm39) T150A probably damaging Het
Mtus2 A G 5: 148,014,725 (GRCm39) N506S probably benign Het
Myh15 G T 16: 48,963,313 (GRCm39) V1085L probably benign Het
Myo9a A G 9: 59,687,048 (GRCm39) N51S probably benign Het
Nlrc3 A T 16: 3,771,304 (GRCm39) L196Q probably damaging Het
Nlrp9c T A 7: 26,074,747 (GRCm39) N816I probably damaging Het
Nsun2 T C 13: 69,767,700 (GRCm39) V218A probably benign Het
Nt5dc1 T C 10: 34,189,673 (GRCm39) E339G possibly damaging Het
Or10ak14 C T 4: 118,611,331 (GRCm39) V135I probably benign Het
Or51b6b A G 7: 103,309,779 (GRCm39) V226A probably damaging Het
Pik3ap1 A G 19: 41,284,828 (GRCm39) I619T probably damaging Het
Plk1 A G 7: 121,759,118 (GRCm39) D118G probably benign Het
Ppat T C 5: 77,070,314 (GRCm39) D168G possibly damaging Het
Preb T C 5: 31,115,849 (GRCm39) E198G probably damaging Het
Psg21 T C 7: 18,386,378 (GRCm39) T203A possibly damaging Het
Rbm17 A G 2: 11,602,942 (GRCm39) V54A probably damaging Het
Rgma T A 7: 73,067,574 (GRCm39) D276E probably damaging Het
Ric8a T C 7: 140,439,471 (GRCm39) L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scarf1 A C 11: 75,416,854 (GRCm39) E765D probably damaging Het
Scart1 A T 7: 139,803,890 (GRCm39) N363Y possibly damaging Het
Sec14l4 G A 11: 3,990,041 (GRCm39) M113I probably benign Het
Senp1 C T 15: 97,980,165 (GRCm39) C60Y probably damaging Het
Slc22a21 T A 11: 53,842,130 (GRCm39) K549N probably benign Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Spata13 T C 14: 60,947,004 (GRCm39) M684T probably damaging Het
Spns1 T C 7: 125,969,958 (GRCm39) T481A probably damaging Het
Stag1 A G 9: 100,668,666 (GRCm39) Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 (GRCm39) V210E probably damaging Het
Tnc C T 4: 63,893,475 (GRCm39) E1604K possibly damaging Het
Tspan31 T C 10: 126,904,365 (GRCm39) D143G probably benign Het
Tspan5 T A 3: 138,603,903 (GRCm39) Y131* probably null Het
Ttc21a A G 9: 119,795,189 (GRCm39) D1070G probably damaging Het
Vmn2r26 C T 6: 124,016,708 (GRCm39) P391S probably benign Het
Vmn2r72 A G 7: 85,387,464 (GRCm39) I700T probably damaging Het
Vps13c A C 9: 67,821,102 (GRCm39) N1204T probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Or8j3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Or8j3c APN 2 86,253,336 (GRCm39) missense probably damaging 0.98
IGL02638:Or8j3c APN 2 86,254,021 (GRCm39) splice site probably null
IGL02863:Or8j3c APN 2 86,253,457 (GRCm39) missense probably benign 0.44
R0211:Or8j3c UTSW 2 86,253,451 (GRCm39) missense probably damaging 0.96
R0211:Or8j3c UTSW 2 86,253,451 (GRCm39) missense probably damaging 0.96
R1486:Or8j3c UTSW 2 86,253,825 (GRCm39) missense probably damaging 0.99
R3695:Or8j3c UTSW 2 86,253,987 (GRCm39) missense probably damaging 0.96
R3981:Or8j3c UTSW 2 86,253,186 (GRCm39) missense probably damaging 1.00
R4156:Or8j3c UTSW 2 86,253,544 (GRCm39) missense possibly damaging 0.67
R4860:Or8j3c UTSW 2 86,253,301 (GRCm39) missense probably damaging 1.00
R4860:Or8j3c UTSW 2 86,253,301 (GRCm39) missense probably damaging 1.00
R5024:Or8j3c UTSW 2 86,253,805 (GRCm39) missense possibly damaging 0.77
R5351:Or8j3c UTSW 2 86,253,610 (GRCm39) missense probably damaging 1.00
R5566:Or8j3c UTSW 2 86,253,721 (GRCm39) nonsense probably null
R5777:Or8j3c UTSW 2 86,253,669 (GRCm39) missense probably benign 0.00
R6628:Or8j3c UTSW 2 86,253,361 (GRCm39) missense probably benign 0.02
R7039:Or8j3c UTSW 2 86,253,177 (GRCm39) missense possibly damaging 0.48
R7159:Or8j3c UTSW 2 86,253,956 (GRCm39) splice site probably null
R7236:Or8j3c UTSW 2 86,253,533 (GRCm39) nonsense probably null
R7251:Or8j3c UTSW 2 86,253,940 (GRCm39) missense probably benign 0.45
R7575:Or8j3c UTSW 2 86,253,582 (GRCm39) missense probably benign
R7840:Or8j3c UTSW 2 86,253,583 (GRCm39) missense probably benign 0.00
R8048:Or8j3c UTSW 2 86,253,651 (GRCm39) missense probably damaging 1.00
R8167:Or8j3c UTSW 2 86,253,484 (GRCm39) missense probably damaging 1.00
R8465:Or8j3c UTSW 2 86,253,975 (GRCm39) missense probably benign 0.03
R8672:Or8j3c UTSW 2 86,253,976 (GRCm39) missense probably benign
R8871:Or8j3c UTSW 2 86,253,697 (GRCm39) missense probably benign
R9244:Or8j3c UTSW 2 86,253,423 (GRCm39) missense probably damaging 0.97
R9513:Or8j3c UTSW 2 86,253,707 (GRCm39) missense probably damaging 1.00
X0065:Or8j3c UTSW 2 86,253,466 (GRCm39) missense probably benign 0.39
Z1176:Or8j3c UTSW 2 86,253,718 (GRCm39) missense probably benign 0.07
Z1177:Or8j3c UTSW 2 86,253,756 (GRCm39) missense probably benign 0.12
Z1177:Or8j3c UTSW 2 86,253,597 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATTGCTTCTGAAGTTTTAGGTCCTG -3'
(R):5'- TTGCAATTTTGAGGATCCGTTCATC -3'

Sequencing Primer
(F):5'- GAAGTTTTAGGTCCTGACATTTACC -3'
(R):5'- GAGGATCCGTTCATCTGAAGG -3'
Posted On 2014-10-30