Incidental Mutation 'R2327:Tnc'
ID 245678
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Name tenascin C
Synonyms cytotactin, C130033P17Rik, TN-C, hexabrachion, tenascin-C, Hxb, TN
MMRRC Submission 040318-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2327 (G1)
Quality Score 210
Status Not validated
Chromosome 4
Chromosomal Location 63878022-63965252 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63893475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1604 (E1604K)
Ref Sequence ENSEMBL: ENSMUSP00000103000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107372] [ENSMUST00000107377]
AlphaFold Q80YX1
Predicted Effect possibly damaging
Transcript: ENSMUST00000030056
AA Change: E1604K

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: E1604K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107372
AA Change: E1695K

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: E1695K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107377
AA Change: E1604K

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: E1604K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141428
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 64,208,569 (GRCm39) probably null Het
Agbl4 T G 4: 111,383,798 (GRCm39) S218A probably benign Het
Apol11b T C 15: 77,522,153 (GRCm39) E48G probably damaging Het
Atp4a T A 7: 30,419,666 (GRCm39) N676K probably benign Het
Capn5 T A 7: 97,775,574 (GRCm39) S456C probably benign Het
Ccar1 T C 10: 62,600,161 (GRCm39) Y590C probably damaging Het
Ccdc188 G T 16: 18,037,070 (GRCm39) G283W probably damaging Het
Cd69 A G 6: 129,248,351 (GRCm39) V45A probably damaging Het
Col3a1 G T 1: 45,377,771 (GRCm39) probably benign Het
Cyb561a3 A T 19: 10,564,166 (GRCm39) T169S probably benign Het
Cyp2c39 A T 19: 39,527,397 (GRCm39) I248L probably benign Het
Cyp2j13 T C 4: 95,947,344 (GRCm39) T236A possibly damaging Het
Efs A G 14: 55,154,961 (GRCm39) V426A probably benign Het
Eme2 A G 17: 25,113,157 (GRCm39) L136S probably damaging Het
Fastkd1 T A 2: 69,535,872 (GRCm39) K312* probably null Het
Fbxl12 A G 9: 20,553,530 (GRCm39) L19P probably damaging Het
Flg2 T A 3: 93,110,913 (GRCm39) Y980* probably null Het
Fscn2 T A 11: 120,257,527 (GRCm39) I296N probably damaging Het
Gabrg3 A G 7: 56,384,835 (GRCm39) V242A probably benign Het
Galk2 A G 2: 125,817,315 (GRCm39) H368R probably damaging Het
Gm12695 C T 4: 96,657,893 (GRCm39) S92N probably benign Het
Gpalpp1 A T 14: 76,336,031 (GRCm39) S196T probably benign Het
Gpld1 A T 13: 25,168,804 (GRCm39) M773L probably benign Het
Haus8 A G 8: 71,708,289 (GRCm39) probably null Het
Hirip3 A G 7: 126,462,038 (GRCm39) R19G probably damaging Het
Inpp4a A G 1: 37,405,247 (GRCm39) T92A probably damaging Het
Irgm2 A G 11: 58,111,218 (GRCm39) D303G probably damaging Het
Kpna2rt C A 17: 90,217,697 (GRCm39) R16S probably benign Het
Krtap5-2 T G 7: 141,728,748 (GRCm39) S311R unknown Het
Krtdap T A 7: 30,489,185 (GRCm39) probably null Het
Lce1g G T 3: 92,658,140 (GRCm39) S56Y unknown Het
Lrrn1 G A 6: 107,545,794 (GRCm39) V531I probably benign Het
Mctp2 T C 7: 71,861,358 (GRCm39) E429G probably damaging Het
Mrgpra2b T G 7: 47,113,793 (GRCm39) D287A probably damaging Het
Mterf3 T C 13: 67,076,258 (GRCm39) T150A probably damaging Het
Mtus2 A G 5: 148,014,725 (GRCm39) N506S probably benign Het
Myh15 G T 16: 48,963,313 (GRCm39) V1085L probably benign Het
Myo9a A G 9: 59,687,048 (GRCm39) N51S probably benign Het
Nlrc3 A T 16: 3,771,304 (GRCm39) L196Q probably damaging Het
Nlrp9c T A 7: 26,074,747 (GRCm39) N816I probably damaging Het
Nsun2 T C 13: 69,767,700 (GRCm39) V218A probably benign Het
Nt5dc1 T C 10: 34,189,673 (GRCm39) E339G possibly damaging Het
Or10ak14 C T 4: 118,611,331 (GRCm39) V135I probably benign Het
Or51b6b A G 7: 103,309,779 (GRCm39) V226A probably damaging Het
Or8j3c A T 2: 86,253,165 (GRCm39) L285* probably null Het
Pik3ap1 A G 19: 41,284,828 (GRCm39) I619T probably damaging Het
Plk1 A G 7: 121,759,118 (GRCm39) D118G probably benign Het
Ppat T C 5: 77,070,314 (GRCm39) D168G possibly damaging Het
Preb T C 5: 31,115,849 (GRCm39) E198G probably damaging Het
Psg21 T C 7: 18,386,378 (GRCm39) T203A possibly damaging Het
Rbm17 A G 2: 11,602,942 (GRCm39) V54A probably damaging Het
Rgma T A 7: 73,067,574 (GRCm39) D276E probably damaging Het
Ric8a T C 7: 140,439,471 (GRCm39) L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scarf1 A C 11: 75,416,854 (GRCm39) E765D probably damaging Het
Scart1 A T 7: 139,803,890 (GRCm39) N363Y possibly damaging Het
Sec14l4 G A 11: 3,990,041 (GRCm39) M113I probably benign Het
Senp1 C T 15: 97,980,165 (GRCm39) C60Y probably damaging Het
Slc22a21 T A 11: 53,842,130 (GRCm39) K549N probably benign Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Spata13 T C 14: 60,947,004 (GRCm39) M684T probably damaging Het
Spns1 T C 7: 125,969,958 (GRCm39) T481A probably damaging Het
Stag1 A G 9: 100,668,666 (GRCm39) Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 (GRCm39) V210E probably damaging Het
Tspan31 T C 10: 126,904,365 (GRCm39) D143G probably benign Het
Tspan5 T A 3: 138,603,903 (GRCm39) Y131* probably null Het
Ttc21a A G 9: 119,795,189 (GRCm39) D1070G probably damaging Het
Vmn2r26 C T 6: 124,016,708 (GRCm39) P391S probably benign Het
Vmn2r72 A G 7: 85,387,464 (GRCm39) I700T probably damaging Het
Vps13c A C 9: 67,821,102 (GRCm39) N1204T probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 63,935,061 (GRCm39) splice site probably benign
IGL00531:Tnc APN 4 63,889,390 (GRCm39) splice site probably benign
IGL00674:Tnc APN 4 63,883,844 (GRCm39) missense probably damaging 1.00
IGL01015:Tnc APN 4 63,935,571 (GRCm39) missense probably benign 0.19
IGL01090:Tnc APN 4 63,918,317 (GRCm39) missense probably damaging 1.00
IGL01310:Tnc APN 4 63,931,314 (GRCm39) missense probably benign 0.03
IGL01331:Tnc APN 4 63,901,112 (GRCm39) missense probably damaging 0.99
IGL01393:Tnc APN 4 63,932,291 (GRCm39) splice site probably benign
IGL01411:Tnc APN 4 63,918,959 (GRCm39) missense probably damaging 0.96
IGL01472:Tnc APN 4 63,924,656 (GRCm39) missense probably benign 0.00
IGL01552:Tnc APN 4 63,888,645 (GRCm39) missense probably damaging 1.00
IGL01661:Tnc APN 4 63,888,544 (GRCm39) splice site probably benign
IGL01669:Tnc APN 4 63,918,938 (GRCm39) missense probably damaging 1.00
IGL01912:Tnc APN 4 63,926,977 (GRCm39) missense probably damaging 1.00
IGL02028:Tnc APN 4 63,884,909 (GRCm39) splice site probably benign
IGL02100:Tnc APN 4 63,918,398 (GRCm39) missense possibly damaging 0.84
IGL02549:Tnc APN 4 63,933,309 (GRCm39) missense probably damaging 1.00
IGL02642:Tnc APN 4 63,883,816 (GRCm39) splice site probably benign
IGL02712:Tnc APN 4 63,893,493 (GRCm39) missense probably damaging 1.00
IGL02876:Tnc APN 4 63,933,338 (GRCm39) missense possibly damaging 0.56
IGL02886:Tnc APN 4 63,918,344 (GRCm39) missense probably damaging 0.96
IGL02972:Tnc APN 4 63,894,715 (GRCm39) missense probably benign 0.11
IGL03073:Tnc APN 4 63,889,461 (GRCm39) missense possibly damaging 0.58
IGL03116:Tnc APN 4 63,932,270 (GRCm39) missense probably damaging 1.00
IGL03181:Tnc APN 4 63,885,543 (GRCm39) missense possibly damaging 0.95
IGL03358:Tnc APN 4 63,935,852 (GRCm39) nonsense probably null
tancredo UTSW 4 63,911,534 (GRCm39) nonsense probably null
BB009:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
BB019:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
P0020:Tnc UTSW 4 63,927,094 (GRCm39) missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 63,935,973 (GRCm39) missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63,882,904 (GRCm39) missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63,882,904 (GRCm39) missense probably damaging 1.00
R0243:Tnc UTSW 4 63,888,657 (GRCm39) missense probably damaging 0.98
R0362:Tnc UTSW 4 63,935,679 (GRCm39) missense probably damaging 1.00
R0410:Tnc UTSW 4 63,925,931 (GRCm39) missense probably benign 0.00
R0420:Tnc UTSW 4 63,918,396 (GRCm39) missense probably benign 0.00
R0540:Tnc UTSW 4 63,938,692 (GRCm39) missense probably damaging 1.00
R0650:Tnc UTSW 4 63,926,971 (GRCm39) missense probably benign 0.00
R1019:Tnc UTSW 4 63,880,319 (GRCm39) missense probably damaging 1.00
R1102:Tnc UTSW 4 63,938,705 (GRCm39) missense probably benign 0.05
R1126:Tnc UTSW 4 63,936,357 (GRCm39) missense probably damaging 0.99
R1141:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1142:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1307:Tnc UTSW 4 63,927,096 (GRCm39) missense probably damaging 0.98
R1322:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1414:Tnc UTSW 4 63,883,932 (GRCm39) splice site probably benign
R1470:Tnc UTSW 4 63,884,811 (GRCm39) missense probably damaging 1.00
R1470:Tnc UTSW 4 63,884,811 (GRCm39) missense probably damaging 1.00
R1499:Tnc UTSW 4 63,882,991 (GRCm39) missense probably benign 0.15
R1506:Tnc UTSW 4 63,925,921 (GRCm39) missense possibly damaging 0.90
R1597:Tnc UTSW 4 63,924,621 (GRCm39) missense probably benign
R1750:Tnc UTSW 4 63,890,972 (GRCm39) missense probably damaging 1.00
R1765:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1783:Tnc UTSW 4 63,936,333 (GRCm39) missense probably damaging 0.98
R1808:Tnc UTSW 4 63,918,168 (GRCm39) missense probably damaging 1.00
R1903:Tnc UTSW 4 63,918,299 (GRCm39) missense probably benign 0.00
R1932:Tnc UTSW 4 63,911,262 (GRCm39) critical splice donor site probably null
R1941:Tnc UTSW 4 63,933,201 (GRCm39) missense probably damaging 1.00
R1983:Tnc UTSW 4 63,902,867 (GRCm39) missense possibly damaging 0.95
R2024:Tnc UTSW 4 63,882,858 (GRCm39) missense probably damaging 1.00
R2075:Tnc UTSW 4 63,913,903 (GRCm39) missense possibly damaging 0.94
R2444:Tnc UTSW 4 63,933,200 (GRCm39) missense probably damaging 1.00
R2982:Tnc UTSW 4 63,938,756 (GRCm39) missense possibly damaging 0.81
R3874:Tnc UTSW 4 63,926,947 (GRCm39) missense probably damaging 1.00
R4110:Tnc UTSW 4 63,933,188 (GRCm39) missense probably damaging 1.00
R4360:Tnc UTSW 4 63,935,161 (GRCm39) missense probably benign 0.35
R4371:Tnc UTSW 4 63,888,588 (GRCm39) missense probably damaging 1.00
R4434:Tnc UTSW 4 63,926,066 (GRCm39) missense possibly damaging 0.91
R4438:Tnc UTSW 4 63,926,066 (GRCm39) missense possibly damaging 0.91
R4570:Tnc UTSW 4 63,913,909 (GRCm39) missense probably damaging 0.99
R4595:Tnc UTSW 4 63,913,982 (GRCm39) missense probably damaging 1.00
R4749:Tnc UTSW 4 63,913,876 (GRCm39) missense possibly damaging 0.56
R4756:Tnc UTSW 4 63,885,580 (GRCm39) missense probably damaging 0.99
R4824:Tnc UTSW 4 63,935,857 (GRCm39) nonsense probably null
R4957:Tnc UTSW 4 63,894,793 (GRCm39) missense probably damaging 1.00
R4977:Tnc UTSW 4 63,924,485 (GRCm39) missense possibly damaging 0.82
R5001:Tnc UTSW 4 63,918,299 (GRCm39) missense probably benign 0.16
R5001:Tnc UTSW 4 63,902,726 (GRCm39) missense probably damaging 1.00
R5015:Tnc UTSW 4 63,924,739 (GRCm39) missense probably damaging 1.00
R5049:Tnc UTSW 4 63,936,223 (GRCm39) missense probably damaging 1.00
R5066:Tnc UTSW 4 63,893,466 (GRCm39) missense probably damaging 0.96
R5073:Tnc UTSW 4 63,938,648 (GRCm39) missense probably damaging 1.00
R5116:Tnc UTSW 4 63,885,452 (GRCm39) critical splice donor site probably null
R5195:Tnc UTSW 4 63,885,489 (GRCm39) missense probably damaging 1.00
R5200:Tnc UTSW 4 63,889,515 (GRCm39) missense probably damaging 1.00
R5221:Tnc UTSW 4 63,911,534 (GRCm39) nonsense probably null
R5237:Tnc UTSW 4 63,880,333 (GRCm39) missense probably damaging 1.00
R5265:Tnc UTSW 4 63,911,443 (GRCm39) missense probably benign 0.00
R5275:Tnc UTSW 4 63,882,967 (GRCm39) nonsense probably null
R5346:Tnc UTSW 4 63,926,892 (GRCm39) missense probably benign
R5409:Tnc UTSW 4 63,925,654 (GRCm39) missense probably damaging 1.00
R5409:Tnc UTSW 4 63,884,773 (GRCm39) missense probably damaging 1.00
R5469:Tnc UTSW 4 63,932,162 (GRCm39) splice site probably null
R5518:Tnc UTSW 4 63,935,916 (GRCm39) missense probably damaging 1.00
R5560:Tnc UTSW 4 63,926,946 (GRCm39) missense probably damaging 1.00
R5588:Tnc UTSW 4 63,924,659 (GRCm39) missense possibly damaging 0.57
R5686:Tnc UTSW 4 63,925,967 (GRCm39) splice site probably null
R5686:Tnc UTSW 4 63,927,032 (GRCm39) missense possibly damaging 0.78
R5837:Tnc UTSW 4 63,931,451 (GRCm39) missense probably damaging 1.00
R5976:Tnc UTSW 4 63,936,403 (GRCm39) missense probably benign 0.17
R6156:Tnc UTSW 4 63,888,589 (GRCm39) missense probably damaging 1.00
R6182:Tnc UTSW 4 63,927,033 (GRCm39) missense probably damaging 0.99
R6360:Tnc UTSW 4 63,918,970 (GRCm39) missense probably damaging 1.00
R6416:Tnc UTSW 4 63,926,053 (GRCm39) missense probably benign 0.05
R6778:Tnc UTSW 4 63,913,835 (GRCm39) missense probably benign 0.12
R6798:Tnc UTSW 4 63,883,841 (GRCm39) missense probably benign 0.02
R6799:Tnc UTSW 4 63,883,841 (GRCm39) missense probably benign 0.02
R6943:Tnc UTSW 4 63,900,982 (GRCm39) missense probably damaging 0.97
R7027:Tnc UTSW 4 63,902,826 (GRCm39) missense probably benign 0.02
R7183:Tnc UTSW 4 63,931,365 (GRCm39) missense probably damaging 1.00
R7204:Tnc UTSW 4 63,889,392 (GRCm39) splice site probably null
R7317:Tnc UTSW 4 63,890,959 (GRCm39) missense probably damaging 0.99
R7323:Tnc UTSW 4 63,889,469 (GRCm39) missense probably damaging 0.96
R7327:Tnc UTSW 4 63,882,999 (GRCm39) splice site probably null
R7382:Tnc UTSW 4 63,932,280 (GRCm39) nonsense probably null
R7399:Tnc UTSW 4 63,938,894 (GRCm39) start gained probably benign
R7479:Tnc UTSW 4 63,935,865 (GRCm39) missense possibly damaging 0.95
R7585:Tnc UTSW 4 63,938,648 (GRCm39) missense probably damaging 1.00
R7932:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
R7947:Tnc UTSW 4 63,935,580 (GRCm39) missense probably damaging 1.00
R7974:Tnc UTSW 4 63,918,961 (GRCm39) missense possibly damaging 0.84
R7991:Tnc UTSW 4 63,926,983 (GRCm39) missense probably benign 0.42
R8004:Tnc UTSW 4 63,902,894 (GRCm39) missense probably benign 0.04
R8080:Tnc UTSW 4 63,894,706 (GRCm39) missense possibly damaging 0.52
R8109:Tnc UTSW 4 63,927,000 (GRCm39) missense probably benign 0.11
R8145:Tnc UTSW 4 63,935,716 (GRCm39) missense probably benign
R8340:Tnc UTSW 4 63,926,036 (GRCm39) missense probably damaging 1.00
R8360:Tnc UTSW 4 63,885,511 (GRCm39) missense probably benign 0.00
R8671:Tnc UTSW 4 63,935,683 (GRCm39) missense probably damaging 1.00
R8691:Tnc UTSW 4 63,880,313 (GRCm39) missense probably damaging 1.00
R8759:Tnc UTSW 4 63,924,501 (GRCm39) missense possibly damaging 0.86
R8864:Tnc UTSW 4 63,911,296 (GRCm39) missense probably damaging 0.98
R8927:Tnc UTSW 4 63,925,595 (GRCm39) missense probably damaging 1.00
R8928:Tnc UTSW 4 63,925,595 (GRCm39) missense probably damaging 1.00
R8949:Tnc UTSW 4 63,927,087 (GRCm39) missense probably damaging 1.00
R8956:Tnc UTSW 4 63,918,970 (GRCm39) missense probably damaging 1.00
R9016:Tnc UTSW 4 63,935,331 (GRCm39) missense probably benign 0.23
R9049:Tnc UTSW 4 63,918,247 (GRCm39) missense possibly damaging 0.83
R9097:Tnc UTSW 4 63,888,622 (GRCm39) missense possibly damaging 0.62
R9114:Tnc UTSW 4 63,890,973 (GRCm39) missense probably benign 0.03
R9151:Tnc UTSW 4 63,938,686 (GRCm39) missense possibly damaging 0.46
R9488:Tnc UTSW 4 63,913,942 (GRCm39) missense probably damaging 0.99
R9537:Tnc UTSW 4 63,884,821 (GRCm39) missense probably damaging 0.99
R9666:Tnc UTSW 4 63,926,045 (GRCm39) missense probably damaging 1.00
R9700:Tnc UTSW 4 63,933,186 (GRCm39) missense probably damaging 0.99
R9703:Tnc UTSW 4 63,889,412 (GRCm39) missense probably benign 0.00
R9771:Tnc UTSW 4 63,925,600 (GRCm39) missense probably damaging 1.00
S24628:Tnc UTSW 4 63,936,249 (GRCm39) missense probably damaging 1.00
Z1177:Tnc UTSW 4 63,925,663 (GRCm39) nonsense probably null
Z1177:Tnc UTSW 4 63,878,781 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGAGGGCATTCAGGATGTC -3'
(R):5'- CGGTTTGGAGGCTATGACAAG -3'

Sequencing Primer
(F):5'- GGCAACCCAGTTTATTAGAGGC -3'
(R):5'- GGAAGTGTGGAAGAGGCTCCC -3'
Posted On 2014-10-30