Incidental Mutation 'R2327:Or10ak14'
ID 245682
Institutional Source Beutler Lab
Gene Symbol Or10ak14
Ensembl Gene ENSMUSG00000095218
Gene Name olfactory receptor family 10 subfamily AK member 14
Synonyms GA_x6K02T2QD9B-18795136-18796077, MOR259-4P, MOR259-9, Olfr1338, MOR259-4P, Olfr1524-ps1
MMRRC Submission 040318-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.778) question?
Stock # R2327 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118610386-118614155 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118611331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 135 (V135I)
Ref Sequence ENSEMBL: ENSMUSP00000092427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084315] [ENSMUST00000214922] [ENSMUST00000216559]
AlphaFold A0A1L1SSB4
Predicted Effect probably benign
Transcript: ENSMUST00000084315
AA Change: V135I

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092427
Gene: ENSMUSG00000095218
AA Change: V135I

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 3.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1e-8 PFAM
Pfam:7tm_1 42 291 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214922
AA Change: V137I

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216559
AA Change: V137I

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 64,208,569 (GRCm39) probably null Het
Agbl4 T G 4: 111,383,798 (GRCm39) S218A probably benign Het
Apol11b T C 15: 77,522,153 (GRCm39) E48G probably damaging Het
Atp4a T A 7: 30,419,666 (GRCm39) N676K probably benign Het
Capn5 T A 7: 97,775,574 (GRCm39) S456C probably benign Het
Ccar1 T C 10: 62,600,161 (GRCm39) Y590C probably damaging Het
Ccdc188 G T 16: 18,037,070 (GRCm39) G283W probably damaging Het
Cd69 A G 6: 129,248,351 (GRCm39) V45A probably damaging Het
Col3a1 G T 1: 45,377,771 (GRCm39) probably benign Het
Cyb561a3 A T 19: 10,564,166 (GRCm39) T169S probably benign Het
Cyp2c39 A T 19: 39,527,397 (GRCm39) I248L probably benign Het
Cyp2j13 T C 4: 95,947,344 (GRCm39) T236A possibly damaging Het
Efs A G 14: 55,154,961 (GRCm39) V426A probably benign Het
Eme2 A G 17: 25,113,157 (GRCm39) L136S probably damaging Het
Fastkd1 T A 2: 69,535,872 (GRCm39) K312* probably null Het
Fbxl12 A G 9: 20,553,530 (GRCm39) L19P probably damaging Het
Flg2 T A 3: 93,110,913 (GRCm39) Y980* probably null Het
Fscn2 T A 11: 120,257,527 (GRCm39) I296N probably damaging Het
Gabrg3 A G 7: 56,384,835 (GRCm39) V242A probably benign Het
Galk2 A G 2: 125,817,315 (GRCm39) H368R probably damaging Het
Gm12695 C T 4: 96,657,893 (GRCm39) S92N probably benign Het
Gpalpp1 A T 14: 76,336,031 (GRCm39) S196T probably benign Het
Gpld1 A T 13: 25,168,804 (GRCm39) M773L probably benign Het
Haus8 A G 8: 71,708,289 (GRCm39) probably null Het
Hirip3 A G 7: 126,462,038 (GRCm39) R19G probably damaging Het
Inpp4a A G 1: 37,405,247 (GRCm39) T92A probably damaging Het
Irgm2 A G 11: 58,111,218 (GRCm39) D303G probably damaging Het
Kpna2rt C A 17: 90,217,697 (GRCm39) R16S probably benign Het
Krtap5-2 T G 7: 141,728,748 (GRCm39) S311R unknown Het
Krtdap T A 7: 30,489,185 (GRCm39) probably null Het
Lce1g G T 3: 92,658,140 (GRCm39) S56Y unknown Het
Lrrn1 G A 6: 107,545,794 (GRCm39) V531I probably benign Het
Mctp2 T C 7: 71,861,358 (GRCm39) E429G probably damaging Het
Mrgpra2b T G 7: 47,113,793 (GRCm39) D287A probably damaging Het
Mterf3 T C 13: 67,076,258 (GRCm39) T150A probably damaging Het
Mtus2 A G 5: 148,014,725 (GRCm39) N506S probably benign Het
Myh15 G T 16: 48,963,313 (GRCm39) V1085L probably benign Het
Myo9a A G 9: 59,687,048 (GRCm39) N51S probably benign Het
Nlrc3 A T 16: 3,771,304 (GRCm39) L196Q probably damaging Het
Nlrp9c T A 7: 26,074,747 (GRCm39) N816I probably damaging Het
Nsun2 T C 13: 69,767,700 (GRCm39) V218A probably benign Het
Nt5dc1 T C 10: 34,189,673 (GRCm39) E339G possibly damaging Het
Or51b6b A G 7: 103,309,779 (GRCm39) V226A probably damaging Het
Or8j3c A T 2: 86,253,165 (GRCm39) L285* probably null Het
Pik3ap1 A G 19: 41,284,828 (GRCm39) I619T probably damaging Het
Plk1 A G 7: 121,759,118 (GRCm39) D118G probably benign Het
Ppat T C 5: 77,070,314 (GRCm39) D168G possibly damaging Het
Preb T C 5: 31,115,849 (GRCm39) E198G probably damaging Het
Psg21 T C 7: 18,386,378 (GRCm39) T203A possibly damaging Het
Rbm17 A G 2: 11,602,942 (GRCm39) V54A probably damaging Het
Rgma T A 7: 73,067,574 (GRCm39) D276E probably damaging Het
Ric8a T C 7: 140,439,471 (GRCm39) L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scarf1 A C 11: 75,416,854 (GRCm39) E765D probably damaging Het
Scart1 A T 7: 139,803,890 (GRCm39) N363Y possibly damaging Het
Sec14l4 G A 11: 3,990,041 (GRCm39) M113I probably benign Het
Senp1 C T 15: 97,980,165 (GRCm39) C60Y probably damaging Het
Slc22a21 T A 11: 53,842,130 (GRCm39) K549N probably benign Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Spata13 T C 14: 60,947,004 (GRCm39) M684T probably damaging Het
Spns1 T C 7: 125,969,958 (GRCm39) T481A probably damaging Het
Stag1 A G 9: 100,668,666 (GRCm39) Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 (GRCm39) V210E probably damaging Het
Tnc C T 4: 63,893,475 (GRCm39) E1604K possibly damaging Het
Tspan31 T C 10: 126,904,365 (GRCm39) D143G probably benign Het
Tspan5 T A 3: 138,603,903 (GRCm39) Y131* probably null Het
Ttc21a A G 9: 119,795,189 (GRCm39) D1070G probably damaging Het
Vmn2r26 C T 6: 124,016,708 (GRCm39) P391S probably benign Het
Vmn2r72 A G 7: 85,387,464 (GRCm39) I700T probably damaging Het
Vps13c A C 9: 67,821,102 (GRCm39) N1204T probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Or10ak14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Or10ak14 APN 4 118,610,959 (GRCm39) missense possibly damaging 0.78
IGL02726:Or10ak14 APN 4 118,610,961 (GRCm39) missense probably benign 0.00
IGL02928:Or10ak14 APN 4 118,611,697 (GRCm39) missense probably damaging 1.00
IGL03102:Or10ak14 APN 4 118,611,131 (GRCm39) missense probably benign 0.00
R0062:Or10ak14 UTSW 4 118,611,100 (GRCm39) missense probably benign 0.00
R0062:Or10ak14 UTSW 4 118,611,100 (GRCm39) missense probably benign 0.00
R0299:Or10ak14 UTSW 4 118,611,732 (GRCm39) start codon destroyed probably null 0.82
R0501:Or10ak14 UTSW 4 118,611,027 (GRCm39) missense probably benign 0.00
R1301:Or10ak14 UTSW 4 118,610,816 (GRCm39) missense probably benign
R1719:Or10ak14 UTSW 4 118,610,797 (GRCm39) missense possibly damaging 0.78
R3110:Or10ak14 UTSW 4 118,611,421 (GRCm39) missense probably damaging 0.99
R3112:Or10ak14 UTSW 4 118,611,421 (GRCm39) missense probably damaging 0.99
R4582:Or10ak14 UTSW 4 118,611,090 (GRCm39) missense probably damaging 1.00
R4615:Or10ak14 UTSW 4 118,611,334 (GRCm39) missense probably benign 0.34
R5640:Or10ak14 UTSW 4 118,610,986 (GRCm39) missense probably benign 0.07
R6513:Or10ak14 UTSW 4 118,611,224 (GRCm39) nonsense probably null
R6889:Or10ak14 UTSW 4 118,611,504 (GRCm39) missense probably damaging 0.99
R7157:Or10ak14 UTSW 4 118,611,615 (GRCm39) missense possibly damaging 0.93
R7168:Or10ak14 UTSW 4 118,611,048 (GRCm39) missense probably damaging 0.98
R7378:Or10ak14 UTSW 4 118,611,372 (GRCm39) missense possibly damaging 0.74
R7451:Or10ak14 UTSW 4 118,610,884 (GRCm39) missense probably benign 0.03
R7770:Or10ak14 UTSW 4 118,611,254 (GRCm39) missense probably benign 0.04
R7847:Or10ak14 UTSW 4 118,611,565 (GRCm39) missense possibly damaging 0.79
R8839:Or10ak14 UTSW 4 118,611,411 (GRCm39) missense probably damaging 0.99
R8942:Or10ak14 UTSW 4 118,611,594 (GRCm39) missense possibly damaging 0.94
R9274:Or10ak14 UTSW 4 118,610,883 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCATGCAAGCCAGACTACG -3'
(R):5'- ACAGCTGCACACTCCTATGTAC -3'

Sequencing Primer
(F):5'- GACTACGCACTGAAGGACCTTC -3'
(R):5'- TGGATATGAGCTATGTCACTACCACC -3'
Posted On 2014-10-30