Incidental Mutation 'R2327:Mtus2'
ID245685
Institutional Source Beutler Lab
Gene Symbol Mtus2
Ensembl Gene ENSMUSG00000029651
Gene Namemicrotubule associated tumor suppressor candidate 2
Synonyms
MMRRC Submission 040318-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R2327 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location147957320-148316065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148077915 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 506 (N506S)
Ref Sequence ENSEMBL: ENSMUSP00000082694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085558] [ENSMUST00000129092]
Predicted Effect probably benign
Transcript: ENSMUST00000085558
AA Change: N506S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082694
Gene: ENSMUSG00000029651
AA Change: N506S

DomainStartEndE-ValueType
internal_repeat_1 57 290 2.46e-5 PROSPERO
internal_repeat_1 312 525 2.46e-5 PROSPERO
low complexity region 530 541 N/A INTRINSIC
low complexity region 802 818 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
coiled coil region 1029 1080 N/A INTRINSIC
SCOP:d1fxkc_ 1167 1294 3e-4 SMART
low complexity region 1332 1349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149336
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 63,971,120 probably null Het
Agbl4 T G 4: 111,526,601 S218A probably benign Het
Apol11b T C 15: 77,637,953 E48G probably damaging Het
Atp4a T A 7: 30,720,241 N676K probably benign Het
Capn5 T A 7: 98,126,367 S456C probably benign Het
Ccar1 T C 10: 62,764,382 Y590C probably damaging Het
Ccdc188 G T 16: 18,219,206 G283W probably damaging Het
Cd163l1 A T 7: 140,223,977 N363Y possibly damaging Het
Cd69 A G 6: 129,271,388 V45A probably damaging Het
Col3a1 G T 1: 45,338,611 probably benign Het
Cyb561a3 A T 19: 10,586,802 T169S probably benign Het
Cyp2c39 A T 19: 39,538,953 I248L probably benign Het
Cyp2j13 T C 4: 96,059,107 T236A possibly damaging Het
Efs A G 14: 54,917,504 V426A probably benign Het
Eme2 A G 17: 24,894,183 L136S probably damaging Het
Fastkd1 T A 2: 69,705,528 K312* probably null Het
Fbxl12 A G 9: 20,642,234 L19P probably damaging Het
Flg2 T A 3: 93,203,606 Y980* probably null Het
Fscn2 T A 11: 120,366,701 I296N probably damaging Het
Gabrg3 A G 7: 56,735,087 V242A probably benign Het
Galk2 A G 2: 125,975,395 H368R probably damaging Het
Gm10184 C A 17: 89,910,269 R16S probably benign Het
Gm12695 C T 4: 96,769,656 S92N probably benign Het
Gpalpp1 A T 14: 76,098,591 S196T probably benign Het
Gpld1 A T 13: 24,984,821 M773L probably benign Het
Haus8 A G 8: 71,255,645 probably null Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Inpp4a A G 1: 37,366,166 T92A probably damaging Het
Irgm2 A G 11: 58,220,392 D303G probably damaging Het
Krtap5-2 T G 7: 142,175,011 S311R unknown Het
Krtdap T A 7: 30,789,760 probably null Het
Lce1g G T 3: 92,750,833 S56Y unknown Het
Lrrn1 G A 6: 107,568,833 V531I probably benign Het
Mctp2 T C 7: 72,211,610 E429G probably damaging Het
Mrgpra2b T G 7: 47,464,045 D287A probably damaging Het
Mterf3 T C 13: 66,928,194 T150A probably damaging Het
Myh15 G T 16: 49,142,950 V1085L probably benign Het
Myo9a A G 9: 59,779,765 N51S probably benign Het
Nlrc3 A T 16: 3,953,440 L196Q probably damaging Het
Nlrp9c T A 7: 26,375,322 N816I probably damaging Het
Nsun2 T C 13: 69,619,581 V218A probably benign Het
Nt5dc1 T C 10: 34,313,677 E339G possibly damaging Het
Olfr1062 A T 2: 86,422,821 L285* probably null Het
Olfr1338 C T 4: 118,754,134 V135I probably benign Het
Olfr623 A G 7: 103,660,572 V226A probably damaging Het
Pik3ap1 A G 19: 41,296,389 I619T probably damaging Het
Plk1 A G 7: 122,159,895 D118G probably benign Het
Ppat T C 5: 76,922,467 D168G possibly damaging Het
Preb T C 5: 30,958,505 E198G probably damaging Het
Psg21 T C 7: 18,652,453 T203A possibly damaging Het
Rbm17 A G 2: 11,598,131 V54A probably damaging Het
Rgma T A 7: 73,417,826 D276E probably damaging Het
Ric8a T C 7: 140,859,558 L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scarf1 A C 11: 75,526,028 E765D probably damaging Het
Sec14l4 G A 11: 4,040,041 M113I probably benign Het
Senp1 C T 15: 98,082,284 C60Y probably damaging Het
Slc22a21 T A 11: 53,951,304 K549N probably benign Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Spata13 T C 14: 60,709,555 M684T probably damaging Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Stag1 A G 9: 100,786,613 Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 V210E probably damaging Het
Tnc C T 4: 63,975,238 E1604K possibly damaging Het
Tspan31 T C 10: 127,068,496 D143G probably benign Het
Tspan5 T A 3: 138,898,142 Y131* probably null Het
Ttc21a A G 9: 119,966,123 D1070G probably damaging Het
Vmn2r26 C T 6: 124,039,749 P391S probably benign Het
Vmn2r72 A G 7: 85,738,256 I700T probably damaging Het
Vps13c A C 9: 67,913,820 N1204T probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Mtus2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Mtus2 APN 5 148077009 unclassified probably null
IGL01911:Mtus2 APN 5 148078220 missense probably benign 0.00
IGL01973:Mtus2 APN 5 148303476 splice site probably benign
IGL02452:Mtus2 APN 5 148077663 missense probably benign 0.01
IGL02476:Mtus2 APN 5 148077938 missense probably benign 0.01
IGL02716:Mtus2 APN 5 148236310 missense probably benign 0.05
IGL03194:Mtus2 APN 5 148107103 missense probably damaging 1.00
rumblado UTSW 5 148306708 nonsense probably null
IGL02991:Mtus2 UTSW 5 148313500 missense probably damaging 1.00
PIT4431001:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0310:Mtus2 UTSW 5 148107019 missense probably benign 0.17
R0729:Mtus2 UTSW 5 148077287 missense probably benign 0.08
R0968:Mtus2 UTSW 5 148078184 missense probably benign 0.09
R1231:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1253:Mtus2 UTSW 5 148303570 nonsense probably null
R1556:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1561:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1574:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1750:Mtus2 UTSW 5 148277633 missense probably damaging 0.97
R2318:Mtus2 UTSW 5 148107082 nonsense probably null
R3153:Mtus2 UTSW 5 148083060 missense probably damaging 1.00
R3154:Mtus2 UTSW 5 148303273 intron probably benign
R3158:Mtus2 UTSW 5 148231827 missense probably damaging 1.00
R3548:Mtus2 UTSW 5 148295506 missense probably damaging 1.00
R3861:Mtus2 UTSW 5 148313413 missense probably damaging 1.00
R4395:Mtus2 UTSW 5 148076622 missense probably benign 0.17
R4396:Mtus2 UTSW 5 148203938 missense possibly damaging 0.81
R4667:Mtus2 UTSW 5 148298260 missense possibly damaging 0.64
R4887:Mtus2 UTSW 5 148077103 nonsense probably null
R4931:Mtus2 UTSW 5 148077416 missense probably benign 0.09
R5097:Mtus2 UTSW 5 148295582 missense probably damaging 0.99
R5318:Mtus2 UTSW 5 148076572 missense probably benign 0.05
R5372:Mtus2 UTSW 5 148313412 missense probably damaging 1.00
R5388:Mtus2 UTSW 5 148306708 nonsense probably null
R5622:Mtus2 UTSW 5 148078434 missense probably benign 0.09
R6009:Mtus2 UTSW 5 148306652 missense probably damaging 1.00
R6379:Mtus2 UTSW 5 148077198 missense probably benign 0.00
R6409:Mtus2 UTSW 5 148077615 missense probably benign
R6527:Mtus2 UTSW 5 148277598 critical splice acceptor site probably null
R6853:Mtus2 UTSW 5 148107011 missense probably damaging 1.00
R7001:Mtus2 UTSW 5 148277628 missense probably damaging 1.00
R7187:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R7276:Mtus2 UTSW 5 148076558 missense probably benign
R7594:Mtus2 UTSW 5 148077406 missense probably benign 0.44
X0017:Mtus2 UTSW 5 148277600 missense possibly damaging 0.83
X0028:Mtus2 UTSW 5 148077318 missense probably benign 0.03
Z1088:Mtus2 UTSW 5 148303263 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGATGTCGGACAAGCAGCTC -3'
(R):5'- GGGATGTGTTCAATACCTGCCC -3'

Sequencing Primer
(F):5'- ACAAGCAGCTCCTGTTCG -3'
(R):5'- ATACCTGCCCACCATCCGTG -3'
Posted On2014-10-30