Mutagenetix > Incidental Mutation

Incidental Mutation 'R2327:Atp4a'

245692

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

040318-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R2327 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30720241 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 676 (N676K)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005692
AA Change: N676K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: N676K

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

probably benign
Transcript: ENSMUST00000170371
AA Change: N676K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: N676K

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	A	T	14: 63,971,120		probably null	Het
Agbl4	T	G	4: 111,526,601	S218A	probably benign	Het
Apol11b	T	C	15: 77,637,953	E48G	probably damaging	Het
Capn5	T	A	7: 98,126,367	S456C	probably benign	Het
Ccar1	T	C	10: 62,764,382	Y590C	probably damaging	Het
Ccdc188	G	T	16: 18,219,206	G283W	probably damaging	Het
Cd163l1	A	T	7: 140,223,977	N363Y	possibly damaging	Het
Cd69	A	G	6: 129,271,388	V45A	probably damaging	Het
Col3a1	G	T	1: 45,338,611		probably benign	Het
Cyb561a3	A	T	19: 10,586,802	T169S	probably benign	Het
Cyp2c39	A	T	19: 39,538,953	I248L	probably benign	Het
Cyp2j13	T	C	4: 96,059,107	T236A	possibly damaging	Het
Efs	A	G	14: 54,917,504	V426A	probably benign	Het
Eme2	A	G	17: 24,894,183	L136S	probably damaging	Het
Fastkd1	T	A	2: 69,705,528	K312*	probably null	Het
Fbxl12	A	G	9: 20,642,234	L19P	probably damaging	Het
Flg2	T	A	3: 93,203,606	Y980*	probably null	Het
Fscn2	T	A	11: 120,366,701	I296N	probably damaging	Het
Gabrg3	A	G	7: 56,735,087	V242A	probably benign	Het
Galk2	A	G	2: 125,975,395	H368R	probably damaging	Het
Gm10184	C	A	17: 89,910,269	R16S	probably benign	Het
Gm12695	C	T	4: 96,769,656	S92N	probably benign	Het
Gpalpp1	A	T	14: 76,098,591	S196T	probably benign	Het
Gpld1	A	T	13: 24,984,821	M773L	probably benign	Het
Haus8	A	G	8: 71,255,645		probably null	Het
Hirip3	A	G	7: 126,862,866	R19G	probably damaging	Het
Inpp4a	A	G	1: 37,366,166	T92A	probably damaging	Het
Irgm2	A	G	11: 58,220,392	D303G	probably damaging	Het
Krtap5-2	T	G	7: 142,175,011	S311R	unknown	Het
Krtdap	T	A	7: 30,789,760		probably null	Het
Lce1g	G	T	3: 92,750,833	S56Y	unknown	Het
Lrrn1	G	A	6: 107,568,833	V531I	probably benign	Het
Mctp2	T	C	7: 72,211,610	E429G	probably damaging	Het
Mrgpra2b	T	G	7: 47,464,045	D287A	probably damaging	Het
Mterf3	T	C	13: 66,928,194	T150A	probably damaging	Het
Mtus2	A	G	5: 148,077,915	N506S	probably benign	Het
Myh15	G	T	16: 49,142,950	V1085L	probably benign	Het
Myo9a	A	G	9: 59,779,765	N51S	probably benign	Het
Nlrc3	A	T	16: 3,953,440	L196Q	probably damaging	Het
Nlrp9c	T	A	7: 26,375,322	N816I	probably damaging	Het
Nsun2	T	C	13: 69,619,581	V218A	probably benign	Het
Nt5dc1	T	C	10: 34,313,677	E339G	possibly damaging	Het
Olfr1062	A	T	2: 86,422,821	L285*	probably null	Het
Olfr1338	C	T	4: 118,754,134	V135I	probably benign	Het
Olfr623	A	G	7: 103,660,572	V226A	probably damaging	Het
Pik3ap1	A	G	19: 41,296,389	I619T	probably damaging	Het
Plk1	A	G	7: 122,159,895	D118G	probably benign	Het
Ppat	T	C	5: 76,922,467	D168G	possibly damaging	Het
Preb	T	C	5: 30,958,505	E198G	probably damaging	Het
Psg21	T	C	7: 18,652,453	T203A	possibly damaging	Het
Rbm17	A	G	2: 11,598,131	V54A	probably damaging	Het
Rgma	T	A	7: 73,417,826	D276E	probably damaging	Het
Ric8a	T	C	7: 140,859,558	L77P	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scarf1	A	C	11: 75,526,028	E765D	probably damaging	Het
Sec14l4	G	A	11: 4,040,041	M113I	probably benign	Het
Senp1	C	T	15: 98,082,284	C60Y	probably damaging	Het
Slc22a21	T	A	11: 53,951,304	K549N	probably benign	Het
Slc39a10	T	C	1: 46,835,996	S49G	probably damaging	Het
Spata13	T	C	14: 60,709,555	M684T	probably damaging	Het
Spns1	T	C	7: 126,370,786	T481A	probably damaging	Het
Stag1	A	G	9: 100,786,613	Y198C	possibly damaging	Het
Tgfbr1	T	A	4: 47,402,833	V210E	probably damaging	Het
Tnc	C	T	4: 63,975,238	E1604K	possibly damaging	Het
Tspan31	T	C	10: 127,068,496	D143G	probably benign	Het
Tspan5	T	A	3: 138,898,142	Y131*	probably null	Het
Ttc21a	A	G	9: 119,966,123	D1070G	probably damaging	Het
Vmn2r26	C	T	6: 124,039,749	P391S	probably benign	Het
Vmn2r72	A	G	7: 85,738,256	I700T	probably damaging	Het
Vps13c	A	C	9: 67,913,820	N1204T	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCGTGGGTATCATCTCAGAG -3'
(R):5'- TCCATGGTTAGAAAGACAGCCC -3'

Sequencing Primer
(F):5'- TATCATCTCAGAGGGCAGCG -3'
(R):5'- ATCACCAGCTTCTGCTGA -3'

Posted On

2014-10-30