Incidental Mutation 'R2327:Mctp2'
ID 245696
Institutional Source Beutler Lab
Gene Symbol Mctp2
Ensembl Gene ENSMUSG00000032776
Gene Name multiple C2 domains, transmembrane 2
Synonyms LOC244049
MMRRC Submission 040318-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.156) question?
Stock # R2327 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 71727578-71956356 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71861358 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 429 (E429G)
Ref Sequence ENSEMBL: ENSMUSP00000078302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079323]
AlphaFold Q5RJH2
Predicted Effect probably damaging
Transcript: ENSMUST00000079323
AA Change: E429G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078302
Gene: ENSMUSG00000032776
AA Change: E429G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
C2 195 291 7.5e-20 SMART
C2 357 451 1.27e-8 SMART
C2 510 606 5.38e-21 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:PRT_C 723 857 2.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 64,208,569 (GRCm39) probably null Het
Agbl4 T G 4: 111,383,798 (GRCm39) S218A probably benign Het
Apol11b T C 15: 77,522,153 (GRCm39) E48G probably damaging Het
Atp4a T A 7: 30,419,666 (GRCm39) N676K probably benign Het
Capn5 T A 7: 97,775,574 (GRCm39) S456C probably benign Het
Ccar1 T C 10: 62,600,161 (GRCm39) Y590C probably damaging Het
Ccdc188 G T 16: 18,037,070 (GRCm39) G283W probably damaging Het
Cd69 A G 6: 129,248,351 (GRCm39) V45A probably damaging Het
Col3a1 G T 1: 45,377,771 (GRCm39) probably benign Het
Cyb561a3 A T 19: 10,564,166 (GRCm39) T169S probably benign Het
Cyp2c39 A T 19: 39,527,397 (GRCm39) I248L probably benign Het
Cyp2j13 T C 4: 95,947,344 (GRCm39) T236A possibly damaging Het
Efs A G 14: 55,154,961 (GRCm39) V426A probably benign Het
Eme2 A G 17: 25,113,157 (GRCm39) L136S probably damaging Het
Fastkd1 T A 2: 69,535,872 (GRCm39) K312* probably null Het
Fbxl12 A G 9: 20,553,530 (GRCm39) L19P probably damaging Het
Flg2 T A 3: 93,110,913 (GRCm39) Y980* probably null Het
Fscn2 T A 11: 120,257,527 (GRCm39) I296N probably damaging Het
Gabrg3 A G 7: 56,384,835 (GRCm39) V242A probably benign Het
Galk2 A G 2: 125,817,315 (GRCm39) H368R probably damaging Het
Gm12695 C T 4: 96,657,893 (GRCm39) S92N probably benign Het
Gpalpp1 A T 14: 76,336,031 (GRCm39) S196T probably benign Het
Gpld1 A T 13: 25,168,804 (GRCm39) M773L probably benign Het
Haus8 A G 8: 71,708,289 (GRCm39) probably null Het
Hirip3 A G 7: 126,462,038 (GRCm39) R19G probably damaging Het
Inpp4a A G 1: 37,405,247 (GRCm39) T92A probably damaging Het
Irgm2 A G 11: 58,111,218 (GRCm39) D303G probably damaging Het
Kpna2rt C A 17: 90,217,697 (GRCm39) R16S probably benign Het
Krtap5-2 T G 7: 141,728,748 (GRCm39) S311R unknown Het
Krtdap T A 7: 30,489,185 (GRCm39) probably null Het
Lce1g G T 3: 92,658,140 (GRCm39) S56Y unknown Het
Lrrn1 G A 6: 107,545,794 (GRCm39) V531I probably benign Het
Mrgpra2b T G 7: 47,113,793 (GRCm39) D287A probably damaging Het
Mterf3 T C 13: 67,076,258 (GRCm39) T150A probably damaging Het
Mtus2 A G 5: 148,014,725 (GRCm39) N506S probably benign Het
Myh15 G T 16: 48,963,313 (GRCm39) V1085L probably benign Het
Myo9a A G 9: 59,687,048 (GRCm39) N51S probably benign Het
Nlrc3 A T 16: 3,771,304 (GRCm39) L196Q probably damaging Het
Nlrp9c T A 7: 26,074,747 (GRCm39) N816I probably damaging Het
Nsun2 T C 13: 69,767,700 (GRCm39) V218A probably benign Het
Nt5dc1 T C 10: 34,189,673 (GRCm39) E339G possibly damaging Het
Or10ak14 C T 4: 118,611,331 (GRCm39) V135I probably benign Het
Or51b6b A G 7: 103,309,779 (GRCm39) V226A probably damaging Het
Or8j3c A T 2: 86,253,165 (GRCm39) L285* probably null Het
Pik3ap1 A G 19: 41,284,828 (GRCm39) I619T probably damaging Het
Plk1 A G 7: 121,759,118 (GRCm39) D118G probably benign Het
Ppat T C 5: 77,070,314 (GRCm39) D168G possibly damaging Het
Preb T C 5: 31,115,849 (GRCm39) E198G probably damaging Het
Psg21 T C 7: 18,386,378 (GRCm39) T203A possibly damaging Het
Rbm17 A G 2: 11,602,942 (GRCm39) V54A probably damaging Het
Rgma T A 7: 73,067,574 (GRCm39) D276E probably damaging Het
Ric8a T C 7: 140,439,471 (GRCm39) L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scarf1 A C 11: 75,416,854 (GRCm39) E765D probably damaging Het
Scart1 A T 7: 139,803,890 (GRCm39) N363Y possibly damaging Het
Sec14l4 G A 11: 3,990,041 (GRCm39) M113I probably benign Het
Senp1 C T 15: 97,980,165 (GRCm39) C60Y probably damaging Het
Slc22a21 T A 11: 53,842,130 (GRCm39) K549N probably benign Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Spata13 T C 14: 60,947,004 (GRCm39) M684T probably damaging Het
Spns1 T C 7: 125,969,958 (GRCm39) T481A probably damaging Het
Stag1 A G 9: 100,668,666 (GRCm39) Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 (GRCm39) V210E probably damaging Het
Tnc C T 4: 63,893,475 (GRCm39) E1604K possibly damaging Het
Tspan31 T C 10: 126,904,365 (GRCm39) D143G probably benign Het
Tspan5 T A 3: 138,603,903 (GRCm39) Y131* probably null Het
Ttc21a A G 9: 119,795,189 (GRCm39) D1070G probably damaging Het
Vmn2r26 C T 6: 124,016,708 (GRCm39) P391S probably benign Het
Vmn2r72 A G 7: 85,387,464 (GRCm39) I700T probably damaging Het
Vps13c A C 9: 67,821,102 (GRCm39) N1204T probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Mctp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mctp2 APN 7 71,835,563 (GRCm39) missense probably damaging 0.96
IGL01296:Mctp2 APN 7 71,878,274 (GRCm39) missense probably benign 0.03
IGL01509:Mctp2 APN 7 71,909,017 (GRCm39) missense probably benign 0.01
IGL02074:Mctp2 APN 7 71,811,006 (GRCm39) missense probably damaging 0.99
IGL02185:Mctp2 APN 7 71,730,571 (GRCm39) missense probably benign 0.13
IGL02238:Mctp2 APN 7 71,739,953 (GRCm39) nonsense probably null
IGL02707:Mctp2 APN 7 71,909,089 (GRCm39) missense possibly damaging 0.95
IGL02820:Mctp2 APN 7 71,895,290 (GRCm39) missense probably damaging 0.99
IGL02869:Mctp2 APN 7 71,878,219 (GRCm39) critical splice donor site probably null
IGL03354:Mctp2 APN 7 71,810,992 (GRCm39) missense probably benign 0.00
IGL03397:Mctp2 APN 7 71,909,025 (GRCm39) missense probably damaging 0.98
IGL03407:Mctp2 APN 7 71,861,400 (GRCm39) missense probably benign 0.05
trifecta UTSW 7 71,909,079 (GRCm39) missense possibly damaging 0.63
triumvirate UTSW 7 71,861,438 (GRCm39) missense probably damaging 1.00
troika UTSW 7 71,835,568 (GRCm39) missense probably damaging 1.00
F5770:Mctp2 UTSW 7 71,771,499 (GRCm39) splice site probably benign
PIT4131001:Mctp2 UTSW 7 71,740,005 (GRCm39) missense probably damaging 1.00
R0013:Mctp2 UTSW 7 71,879,156 (GRCm39) missense probably benign 0.00
R0079:Mctp2 UTSW 7 71,863,864 (GRCm39) splice site probably benign
R0083:Mctp2 UTSW 7 71,878,264 (GRCm39) missense possibly damaging 0.94
R0173:Mctp2 UTSW 7 71,896,855 (GRCm39) critical splice donor site probably null
R0302:Mctp2 UTSW 7 71,740,012 (GRCm39) missense possibly damaging 0.94
R0533:Mctp2 UTSW 7 71,730,570 (GRCm39) missense probably benign 0.00
R0675:Mctp2 UTSW 7 71,732,918 (GRCm39) missense probably damaging 1.00
R1076:Mctp2 UTSW 7 71,835,615 (GRCm39) critical splice acceptor site probably null
R1222:Mctp2 UTSW 7 71,908,887 (GRCm39) missense probably benign
R1356:Mctp2 UTSW 7 71,814,471 (GRCm39) unclassified probably benign
R1628:Mctp2 UTSW 7 71,861,337 (GRCm39) splice site probably null
R1649:Mctp2 UTSW 7 71,811,006 (GRCm39) missense probably damaging 0.99
R1981:Mctp2 UTSW 7 71,814,446 (GRCm39) missense probably benign 0.01
R2256:Mctp2 UTSW 7 71,835,568 (GRCm39) missense probably damaging 1.00
R2257:Mctp2 UTSW 7 71,835,568 (GRCm39) missense probably damaging 1.00
R2407:Mctp2 UTSW 7 71,850,155 (GRCm39) missense probably benign 0.40
R2471:Mctp2 UTSW 7 71,810,909 (GRCm39) nonsense probably null
R3706:Mctp2 UTSW 7 71,863,859 (GRCm39) splice site probably benign
R4023:Mctp2 UTSW 7 71,739,987 (GRCm39) missense possibly damaging 0.88
R4025:Mctp2 UTSW 7 71,739,987 (GRCm39) missense possibly damaging 0.88
R4176:Mctp2 UTSW 7 71,909,085 (GRCm39) missense probably benign
R4272:Mctp2 UTSW 7 71,909,079 (GRCm39) missense possibly damaging 0.63
R4498:Mctp2 UTSW 7 71,833,599 (GRCm39) missense probably damaging 1.00
R4654:Mctp2 UTSW 7 71,739,942 (GRCm39) missense probably damaging 1.00
R4815:Mctp2 UTSW 7 71,909,097 (GRCm39) missense possibly damaging 0.89
R4946:Mctp2 UTSW 7 71,909,017 (GRCm39) missense probably benign 0.00
R5389:Mctp2 UTSW 7 71,863,835 (GRCm39) missense possibly damaging 0.50
R5682:Mctp2 UTSW 7 71,895,207 (GRCm39) critical splice donor site probably null
R5878:Mctp2 UTSW 7 71,863,856 (GRCm39) missense probably benign 0.01
R5918:Mctp2 UTSW 7 71,878,288 (GRCm39) missense probably damaging 1.00
R5956:Mctp2 UTSW 7 71,908,923 (GRCm39) missense probably benign
R5964:Mctp2 UTSW 7 71,752,925 (GRCm39) missense probably damaging 0.97
R5978:Mctp2 UTSW 7 71,739,936 (GRCm39) missense probably damaging 1.00
R6054:Mctp2 UTSW 7 71,908,851 (GRCm39) missense probably benign
R6475:Mctp2 UTSW 7 71,850,092 (GRCm39) critical splice donor site probably null
R6849:Mctp2 UTSW 7 71,861,466 (GRCm39) missense probably damaging 1.00
R6963:Mctp2 UTSW 7 71,877,804 (GRCm39) missense probably damaging 1.00
R7366:Mctp2 UTSW 7 71,908,962 (GRCm39) missense probably benign 0.00
R7468:Mctp2 UTSW 7 71,861,438 (GRCm39) missense probably damaging 1.00
R7746:Mctp2 UTSW 7 71,835,544 (GRCm39) missense probably benign
R7765:Mctp2 UTSW 7 71,740,079 (GRCm39) splice site probably null
R7822:Mctp2 UTSW 7 71,776,935 (GRCm39) missense possibly damaging 0.90
R7984:Mctp2 UTSW 7 71,752,937 (GRCm39) missense possibly damaging 0.94
R8416:Mctp2 UTSW 7 71,852,210 (GRCm39) missense probably benign 0.12
R8678:Mctp2 UTSW 7 71,752,955 (GRCm39) missense probably damaging 1.00
R8819:Mctp2 UTSW 7 71,879,081 (GRCm39) missense probably benign 0.20
R8820:Mctp2 UTSW 7 71,879,081 (GRCm39) missense probably benign 0.20
R8835:Mctp2 UTSW 7 71,852,161 (GRCm39) missense probably benign 0.19
R8897:Mctp2 UTSW 7 71,909,311 (GRCm39) start codon destroyed probably benign 0.27
R8898:Mctp2 UTSW 7 71,752,904 (GRCm39) missense probably damaging 0.99
R9124:Mctp2 UTSW 7 71,909,178 (GRCm39) missense probably damaging 1.00
X0066:Mctp2 UTSW 7 71,909,028 (GRCm39) nonsense probably null
Z1191:Mctp2 UTSW 7 71,835,568 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTAACAGCCCTTCCACATTAAG -3'
(R):5'- GTCTCATCATGGTGACTTCCCG -3'

Sequencing Primer
(F):5'- ACATTAAGTGGCTGCCCAG -3'
(R):5'- ACATGAATGTGTAGCTGCTATAGCC -3'
Posted On 2014-10-30