Incidental Mutation 'R2327:Vmn2r72'
ID245698
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission 040318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2327 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85738256 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 700 (I700T)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably damaging
Transcript: ENSMUST00000063425
AA Change: I700T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: I700T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 63,971,120 probably null Het
Agbl4 T G 4: 111,526,601 S218A probably benign Het
Apol11b T C 15: 77,637,953 E48G probably damaging Het
Atp4a T A 7: 30,720,241 N676K probably benign Het
Capn5 T A 7: 98,126,367 S456C probably benign Het
Ccar1 T C 10: 62,764,382 Y590C probably damaging Het
Ccdc188 G T 16: 18,219,206 G283W probably damaging Het
Cd163l1 A T 7: 140,223,977 N363Y possibly damaging Het
Cd69 A G 6: 129,271,388 V45A probably damaging Het
Col3a1 G T 1: 45,338,611 probably benign Het
Cyb561a3 A T 19: 10,586,802 T169S probably benign Het
Cyp2c39 A T 19: 39,538,953 I248L probably benign Het
Cyp2j13 T C 4: 96,059,107 T236A possibly damaging Het
Efs A G 14: 54,917,504 V426A probably benign Het
Eme2 A G 17: 24,894,183 L136S probably damaging Het
Fastkd1 T A 2: 69,705,528 K312* probably null Het
Fbxl12 A G 9: 20,642,234 L19P probably damaging Het
Flg2 T A 3: 93,203,606 Y980* probably null Het
Fscn2 T A 11: 120,366,701 I296N probably damaging Het
Gabrg3 A G 7: 56,735,087 V242A probably benign Het
Galk2 A G 2: 125,975,395 H368R probably damaging Het
Gm10184 C A 17: 89,910,269 R16S probably benign Het
Gm12695 C T 4: 96,769,656 S92N probably benign Het
Gpalpp1 A T 14: 76,098,591 S196T probably benign Het
Gpld1 A T 13: 24,984,821 M773L probably benign Het
Haus8 A G 8: 71,255,645 probably null Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Inpp4a A G 1: 37,366,166 T92A probably damaging Het
Irgm2 A G 11: 58,220,392 D303G probably damaging Het
Krtap5-2 T G 7: 142,175,011 S311R unknown Het
Krtdap T A 7: 30,789,760 probably null Het
Lce1g G T 3: 92,750,833 S56Y unknown Het
Lrrn1 G A 6: 107,568,833 V531I probably benign Het
Mctp2 T C 7: 72,211,610 E429G probably damaging Het
Mrgpra2b T G 7: 47,464,045 D287A probably damaging Het
Mterf3 T C 13: 66,928,194 T150A probably damaging Het
Mtus2 A G 5: 148,077,915 N506S probably benign Het
Myh15 G T 16: 49,142,950 V1085L probably benign Het
Myo9a A G 9: 59,779,765 N51S probably benign Het
Nlrc3 A T 16: 3,953,440 L196Q probably damaging Het
Nlrp9c T A 7: 26,375,322 N816I probably damaging Het
Nsun2 T C 13: 69,619,581 V218A probably benign Het
Nt5dc1 T C 10: 34,313,677 E339G possibly damaging Het
Olfr1062 A T 2: 86,422,821 L285* probably null Het
Olfr1338 C T 4: 118,754,134 V135I probably benign Het
Olfr623 A G 7: 103,660,572 V226A probably damaging Het
Pik3ap1 A G 19: 41,296,389 I619T probably damaging Het
Plk1 A G 7: 122,159,895 D118G probably benign Het
Ppat T C 5: 76,922,467 D168G possibly damaging Het
Preb T C 5: 30,958,505 E198G probably damaging Het
Psg21 T C 7: 18,652,453 T203A possibly damaging Het
Rbm17 A G 2: 11,598,131 V54A probably damaging Het
Rgma T A 7: 73,417,826 D276E probably damaging Het
Ric8a T C 7: 140,859,558 L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scarf1 A C 11: 75,526,028 E765D probably damaging Het
Sec14l4 G A 11: 4,040,041 M113I probably benign Het
Senp1 C T 15: 98,082,284 C60Y probably damaging Het
Slc22a21 T A 11: 53,951,304 K549N probably benign Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Spata13 T C 14: 60,709,555 M684T probably damaging Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Stag1 A G 9: 100,786,613 Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 V210E probably damaging Het
Tnc C T 4: 63,975,238 E1604K possibly damaging Het
Tspan31 T C 10: 127,068,496 D143G probably benign Het
Tspan5 T A 3: 138,898,142 Y131* probably null Het
Ttc21a A G 9: 119,966,123 D1070G probably damaging Het
Vmn2r26 C T 6: 124,039,749 P391S probably benign Het
Vps13c A C 9: 67,913,820 N1204T probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 synonymous probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R7926:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
Z1176:Vmn2r72 UTSW 7 85749191 missense not run
Predicted Primers PCR Primer
(F):5'- ATTGAATGTATCAGGCAGGTTCC -3'
(R):5'- ATTGGTCATCCCACTACGGTC -3'

Sequencing Primer
(F):5'- GGTTCCTGGCCAAGAAAGCTAC -3'
(R):5'- GGTCATCTGTATCCTGCAGCAG -3'
Posted On2014-10-30