Incidental Mutation 'R2327:Plk1'
ID245701
Institutional Source Beutler Lab
Gene Symbol Plk1
Ensembl Gene ENSMUSG00000030867
Gene Namepolo like kinase 1
SynonymsPlk, STPK13
MMRRC Submission 040318-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2327 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location122159439-122169873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122159895 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 118 (D118G)
Ref Sequence ENSEMBL: ENSMUSP00000145631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033154] [ENSMUST00000206470]
Predicted Effect probably benign
Transcript: ENSMUST00000033154
AA Change: D118G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033154
Gene: ENSMUSG00000030867
AA Change: D118G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 20 35 N/A INTRINSIC
S_TKc 53 305 7.36e-95 SMART
low complexity region 354 365 N/A INTRINSIC
Pfam:POLO_box 418 479 4.4e-24 PFAM
Pfam:POLO_box 516 583 3.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132811
Predicted Effect unknown
Transcript: ENSMUST00000205901
AA Change: D105G
Predicted Effect probably benign
Transcript: ENSMUST00000206470
AA Change: D118G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: The Ser/Thr protein kinase encoded by this gene belongs to the CDC5/Polo subfamily. It is highly expressed during mitosis and may play a role in DNA replication during S phase. This gene is expressed in all embryonic tissues, but restricted to thymus and ovaries in adult tissues. Homozygous knockout mice were embryonic lethal, suggesting that this gene is important for early embryonic development. This gene is thought to be a potential oncogene because it is overexpressed in a variety of tumors and tumor cell lines. Depletion of this protein in cancer cells has been shown to inhibit cell proliferation and suppress oncogenic transformation; hence, it is a target for cancer therapy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display lethality before implantation, embryonic growth arrest, and impaired mitosis. Mice heterozygous for a null mutation display increased tumor incidence and increased incidence of aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 63,971,120 probably null Het
Agbl4 T G 4: 111,526,601 S218A probably benign Het
Apol11b T C 15: 77,637,953 E48G probably damaging Het
Atp4a T A 7: 30,720,241 N676K probably benign Het
Capn5 T A 7: 98,126,367 S456C probably benign Het
Ccar1 T C 10: 62,764,382 Y590C probably damaging Het
Ccdc188 G T 16: 18,219,206 G283W probably damaging Het
Cd163l1 A T 7: 140,223,977 N363Y possibly damaging Het
Cd69 A G 6: 129,271,388 V45A probably damaging Het
Col3a1 G T 1: 45,338,611 probably benign Het
Cyb561a3 A T 19: 10,586,802 T169S probably benign Het
Cyp2c39 A T 19: 39,538,953 I248L probably benign Het
Cyp2j13 T C 4: 96,059,107 T236A possibly damaging Het
Efs A G 14: 54,917,504 V426A probably benign Het
Eme2 A G 17: 24,894,183 L136S probably damaging Het
Fastkd1 T A 2: 69,705,528 K312* probably null Het
Fbxl12 A G 9: 20,642,234 L19P probably damaging Het
Flg2 T A 3: 93,203,606 Y980* probably null Het
Fscn2 T A 11: 120,366,701 I296N probably damaging Het
Gabrg3 A G 7: 56,735,087 V242A probably benign Het
Galk2 A G 2: 125,975,395 H368R probably damaging Het
Gm10184 C A 17: 89,910,269 R16S probably benign Het
Gm12695 C T 4: 96,769,656 S92N probably benign Het
Gpalpp1 A T 14: 76,098,591 S196T probably benign Het
Gpld1 A T 13: 24,984,821 M773L probably benign Het
Haus8 A G 8: 71,255,645 probably null Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Inpp4a A G 1: 37,366,166 T92A probably damaging Het
Irgm2 A G 11: 58,220,392 D303G probably damaging Het
Krtap5-2 T G 7: 142,175,011 S311R unknown Het
Krtdap T A 7: 30,789,760 probably null Het
Lce1g G T 3: 92,750,833 S56Y unknown Het
Lrrn1 G A 6: 107,568,833 V531I probably benign Het
Mctp2 T C 7: 72,211,610 E429G probably damaging Het
Mrgpra2b T G 7: 47,464,045 D287A probably damaging Het
Mterf3 T C 13: 66,928,194 T150A probably damaging Het
Mtus2 A G 5: 148,077,915 N506S probably benign Het
Myh15 G T 16: 49,142,950 V1085L probably benign Het
Myo9a A G 9: 59,779,765 N51S probably benign Het
Nlrc3 A T 16: 3,953,440 L196Q probably damaging Het
Nlrp9c T A 7: 26,375,322 N816I probably damaging Het
Nsun2 T C 13: 69,619,581 V218A probably benign Het
Nt5dc1 T C 10: 34,313,677 E339G possibly damaging Het
Olfr1062 A T 2: 86,422,821 L285* probably null Het
Olfr1338 C T 4: 118,754,134 V135I probably benign Het
Olfr623 A G 7: 103,660,572 V226A probably damaging Het
Pik3ap1 A G 19: 41,296,389 I619T probably damaging Het
Ppat T C 5: 76,922,467 D168G possibly damaging Het
Preb T C 5: 30,958,505 E198G probably damaging Het
Psg21 T C 7: 18,652,453 T203A possibly damaging Het
Rbm17 A G 2: 11,598,131 V54A probably damaging Het
Rgma T A 7: 73,417,826 D276E probably damaging Het
Ric8a T C 7: 140,859,558 L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scarf1 A C 11: 75,526,028 E765D probably damaging Het
Sec14l4 G A 11: 4,040,041 M113I probably benign Het
Senp1 C T 15: 98,082,284 C60Y probably damaging Het
Slc22a21 T A 11: 53,951,304 K549N probably benign Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Spata13 T C 14: 60,709,555 M684T probably damaging Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Stag1 A G 9: 100,786,613 Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 V210E probably damaging Het
Tnc C T 4: 63,975,238 E1604K possibly damaging Het
Tspan31 T C 10: 127,068,496 D143G probably benign Het
Tspan5 T A 3: 138,898,142 Y131* probably null Het
Ttc21a A G 9: 119,966,123 D1070G probably damaging Het
Vmn2r26 C T 6: 124,039,749 P391S probably benign Het
Vmn2r72 A G 7: 85,738,256 I700T probably damaging Het
Vps13c A C 9: 67,913,820 N1204T probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Plk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Plk1 APN 7 122168925 missense probably damaging 0.96
IGL02895:Plk1 APN 7 122169166 missense possibly damaging 0.91
IGL03143:Plk1 APN 7 122161654 intron probably benign
R0018:Plk1 UTSW 7 122168985 critical splice donor site probably null
R1365:Plk1 UTSW 7 122168629 missense probably damaging 1.00
R1710:Plk1 UTSW 7 122168898 missense probably damaging 1.00
R2016:Plk1 UTSW 7 122162440 missense probably damaging 1.00
R2248:Plk1 UTSW 7 122168821 unclassified probably benign
R4887:Plk1 UTSW 7 122168605 missense probably damaging 1.00
R6246:Plk1 UTSW 7 122169436 missense probably damaging 1.00
R7698:Plk1 UTSW 7 122169258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGTAAAGGAGGCTTCG -3'
(R):5'- AGCAACAGGATCTGGTCTCG -3'

Sequencing Primer
(F):5'- GCCAAATGCTTCGAGATCTCAG -3'
(R):5'- AGTTCGGAGTGCCAAGTACC -3'
Posted On2014-10-30