Incidental Mutation 'R2327:Spns1'
ID 245702
Institutional Source Beutler Lab
Gene Symbol Spns1
Ensembl Gene ENSMUSG00000030741
Gene Name SPNS lysolipid transporter 1, lysophospholipid
Synonyms 2210013K02Rik, spinster homolog
MMRRC Submission 040318-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2327 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 125969232-125976622 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125969958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 481 (T481A)
Ref Sequence ENSEMBL: ENSMUSP00000032994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032994] [ENSMUST00000032997] [ENSMUST00000119754] [ENSMUST00000119846] [ENSMUST00000205930] [ENSMUST00000205366] [ENSMUST00000206793] [ENSMUST00000205642] [ENSMUST00000150476] [ENSMUST00000138141]
AlphaFold Q8R0G7
Predicted Effect probably damaging
Transcript: ENSMUST00000032994
AA Change: T481A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032994
Gene: ENSMUSG00000030741
AA Change: T481A

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:Sugar_tr 60 250 4.6e-15 PFAM
Pfam:OATP 60 385 1.5e-9 PFAM
Pfam:MFS_1 65 435 1.8e-34 PFAM
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032997
SMART Domains Protein: ENSMUSP00000032997
Gene: ENSMUSG00000030742

DomainStartEndE-ValueType
Pfam:LAT 1 242 4.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119754
SMART Domains Protein: ENSMUSP00000112555
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.2e-8 PFAM
Pfam:Sugar_tr 60 250 1.3e-14 PFAM
Pfam:MFS_1 65 430 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119846
AA Change: T429A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112954
Gene: ENSMUSG00000030741
AA Change: T429A

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.4e-8 PFAM
Pfam:Sugar_tr 60 250 1.5e-14 PFAM
Pfam:MFS_1 65 433 2.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137263
Predicted Effect possibly damaging
Transcript: ENSMUST00000205930
AA Change: T246A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152000
Predicted Effect probably benign
Transcript: ENSMUST00000205366
Predicted Effect probably benign
Transcript: ENSMUST00000206793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206094
Predicted Effect probably benign
Transcript: ENSMUST00000205642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206731
Predicted Effect probably benign
Transcript: ENSMUST00000150476
SMART Domains Protein: ENSMUSP00000115152
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
Pfam:OATP 28 120 1.3e-8 PFAM
Pfam:Sugar_tr 28 220 1.6e-15 PFAM
Pfam:MFS_1 35 237 2.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138141
SMART Domains Protein: ENSMUSP00000117803
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 151 1.4e-9 PFAM
Pfam:MFS_1 65 149 1.5e-11 PFAM
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 64,208,569 (GRCm39) probably null Het
Agbl4 T G 4: 111,383,798 (GRCm39) S218A probably benign Het
Apol11b T C 15: 77,522,153 (GRCm39) E48G probably damaging Het
Atp4a T A 7: 30,419,666 (GRCm39) N676K probably benign Het
Capn5 T A 7: 97,775,574 (GRCm39) S456C probably benign Het
Ccar1 T C 10: 62,600,161 (GRCm39) Y590C probably damaging Het
Ccdc188 G T 16: 18,037,070 (GRCm39) G283W probably damaging Het
Cd69 A G 6: 129,248,351 (GRCm39) V45A probably damaging Het
Col3a1 G T 1: 45,377,771 (GRCm39) probably benign Het
Cyb561a3 A T 19: 10,564,166 (GRCm39) T169S probably benign Het
Cyp2c39 A T 19: 39,527,397 (GRCm39) I248L probably benign Het
Cyp2j13 T C 4: 95,947,344 (GRCm39) T236A possibly damaging Het
Efs A G 14: 55,154,961 (GRCm39) V426A probably benign Het
Eme2 A G 17: 25,113,157 (GRCm39) L136S probably damaging Het
Fastkd1 T A 2: 69,535,872 (GRCm39) K312* probably null Het
Fbxl12 A G 9: 20,553,530 (GRCm39) L19P probably damaging Het
Flg2 T A 3: 93,110,913 (GRCm39) Y980* probably null Het
Fscn2 T A 11: 120,257,527 (GRCm39) I296N probably damaging Het
Gabrg3 A G 7: 56,384,835 (GRCm39) V242A probably benign Het
Galk2 A G 2: 125,817,315 (GRCm39) H368R probably damaging Het
Gm12695 C T 4: 96,657,893 (GRCm39) S92N probably benign Het
Gpalpp1 A T 14: 76,336,031 (GRCm39) S196T probably benign Het
Gpld1 A T 13: 25,168,804 (GRCm39) M773L probably benign Het
Haus8 A G 8: 71,708,289 (GRCm39) probably null Het
Hirip3 A G 7: 126,462,038 (GRCm39) R19G probably damaging Het
Inpp4a A G 1: 37,405,247 (GRCm39) T92A probably damaging Het
Irgm2 A G 11: 58,111,218 (GRCm39) D303G probably damaging Het
Kpna2rt C A 17: 90,217,697 (GRCm39) R16S probably benign Het
Krtap5-2 T G 7: 141,728,748 (GRCm39) S311R unknown Het
Krtdap T A 7: 30,489,185 (GRCm39) probably null Het
Lce1g G T 3: 92,658,140 (GRCm39) S56Y unknown Het
Lrrn1 G A 6: 107,545,794 (GRCm39) V531I probably benign Het
Mctp2 T C 7: 71,861,358 (GRCm39) E429G probably damaging Het
Mrgpra2b T G 7: 47,113,793 (GRCm39) D287A probably damaging Het
Mterf3 T C 13: 67,076,258 (GRCm39) T150A probably damaging Het
Mtus2 A G 5: 148,014,725 (GRCm39) N506S probably benign Het
Myh15 G T 16: 48,963,313 (GRCm39) V1085L probably benign Het
Myo9a A G 9: 59,687,048 (GRCm39) N51S probably benign Het
Nlrc3 A T 16: 3,771,304 (GRCm39) L196Q probably damaging Het
Nlrp9c T A 7: 26,074,747 (GRCm39) N816I probably damaging Het
Nsun2 T C 13: 69,767,700 (GRCm39) V218A probably benign Het
Nt5dc1 T C 10: 34,189,673 (GRCm39) E339G possibly damaging Het
Or10ak14 C T 4: 118,611,331 (GRCm39) V135I probably benign Het
Or51b6b A G 7: 103,309,779 (GRCm39) V226A probably damaging Het
Or8j3c A T 2: 86,253,165 (GRCm39) L285* probably null Het
Pik3ap1 A G 19: 41,284,828 (GRCm39) I619T probably damaging Het
Plk1 A G 7: 121,759,118 (GRCm39) D118G probably benign Het
Ppat T C 5: 77,070,314 (GRCm39) D168G possibly damaging Het
Preb T C 5: 31,115,849 (GRCm39) E198G probably damaging Het
Psg21 T C 7: 18,386,378 (GRCm39) T203A possibly damaging Het
Rbm17 A G 2: 11,602,942 (GRCm39) V54A probably damaging Het
Rgma T A 7: 73,067,574 (GRCm39) D276E probably damaging Het
Ric8a T C 7: 140,439,471 (GRCm39) L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scarf1 A C 11: 75,416,854 (GRCm39) E765D probably damaging Het
Scart1 A T 7: 139,803,890 (GRCm39) N363Y possibly damaging Het
Sec14l4 G A 11: 3,990,041 (GRCm39) M113I probably benign Het
Senp1 C T 15: 97,980,165 (GRCm39) C60Y probably damaging Het
Slc22a21 T A 11: 53,842,130 (GRCm39) K549N probably benign Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Spata13 T C 14: 60,947,004 (GRCm39) M684T probably damaging Het
Stag1 A G 9: 100,668,666 (GRCm39) Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 (GRCm39) V210E probably damaging Het
Tnc C T 4: 63,893,475 (GRCm39) E1604K possibly damaging Het
Tspan31 T C 10: 126,904,365 (GRCm39) D143G probably benign Het
Tspan5 T A 3: 138,603,903 (GRCm39) Y131* probably null Het
Ttc21a A G 9: 119,795,189 (GRCm39) D1070G probably damaging Het
Vmn2r26 C T 6: 124,016,708 (GRCm39) P391S probably benign Het
Vmn2r72 A G 7: 85,387,464 (GRCm39) I700T probably damaging Het
Vps13c A C 9: 67,821,102 (GRCm39) N1204T probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Spns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Spns1 APN 7 125,970,414 (GRCm39) splice site probably null
IGL02353:Spns1 APN 7 125,974,312 (GRCm39) missense probably damaging 1.00
IGL02561:Spns1 APN 7 125,972,941 (GRCm39) critical splice donor site probably null
IGL03403:Spns1 APN 7 125,970,708 (GRCm39) splice site probably null
R1634:Spns1 UTSW 7 125,970,343 (GRCm39) unclassified probably benign
R3552:Spns1 UTSW 7 125,969,543 (GRCm39) missense possibly damaging 0.94
R3916:Spns1 UTSW 7 125,970,711 (GRCm39) critical splice donor site probably null
R4025:Spns1 UTSW 7 125,976,118 (GRCm39) nonsense probably null
R4095:Spns1 UTSW 7 125,969,958 (GRCm39) missense probably damaging 1.00
R4656:Spns1 UTSW 7 125,973,474 (GRCm39) unclassified probably benign
R4657:Spns1 UTSW 7 125,973,474 (GRCm39) unclassified probably benign
R4697:Spns1 UTSW 7 125,976,209 (GRCm39) missense probably damaging 1.00
R4758:Spns1 UTSW 7 125,969,966 (GRCm39) missense probably damaging 1.00
R5062:Spns1 UTSW 7 125,973,501 (GRCm39) unclassified probably benign
R5371:Spns1 UTSW 7 125,972,936 (GRCm39) unclassified probably benign
R5700:Spns1 UTSW 7 125,971,641 (GRCm39) missense possibly damaging 0.95
R5973:Spns1 UTSW 7 125,969,495 (GRCm39) missense probably damaging 1.00
R5985:Spns1 UTSW 7 125,975,902 (GRCm39) missense probably benign 0.37
R6660:Spns1 UTSW 7 125,974,237 (GRCm39) critical splice donor site probably null
R7175:Spns1 UTSW 7 125,972,961 (GRCm39) missense probably damaging 0.98
R7937:Spns1 UTSW 7 125,973,226 (GRCm39) missense probably damaging 0.99
R8051:Spns1 UTSW 7 125,971,708 (GRCm39) missense probably benign 0.37
R8815:Spns1 UTSW 7 125,971,593 (GRCm39) missense possibly damaging 0.87
R8816:Spns1 UTSW 7 125,971,593 (GRCm39) missense possibly damaging 0.87
R8835:Spns1 UTSW 7 125,971,593 (GRCm39) missense possibly damaging 0.87
R8836:Spns1 UTSW 7 125,971,593 (GRCm39) missense possibly damaging 0.87
R8837:Spns1 UTSW 7 125,971,593 (GRCm39) missense possibly damaging 0.87
R9311:Spns1 UTSW 7 125,972,995 (GRCm39) missense probably damaging 1.00
Z1177:Spns1 UTSW 7 125,971,583 (GRCm39) critical splice donor site probably null
Z1177:Spns1 UTSW 7 125,971,582 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGACCCAAAGCTAAGCTGG -3'
(R):5'- GCCATAGGAAGGTTTTGCCC -3'

Sequencing Primer
(F):5'- ATGCTGGGACTCTTGCCC -3'
(R):5'- CCATAGGAAGGTTTTGCCCGTTAG -3'
Posted On 2014-10-30