Incidental Mutation 'R2327:Haus8'
ID 245708
Institutional Source Beutler Lab
Gene Symbol Haus8
Ensembl Gene ENSMUSG00000035439
Gene Name 4HAUS augmin-like complex, subunit 8
Synonyms 2410004L22Rik, Hice1
MMRRC Submission 040318-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.901) question?
Stock # R2327 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 71703241-71725234 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 71708289 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035960] [ENSMUST00000035960] [ENSMUST00000110071] [ENSMUST00000110071] [ENSMUST00000123495]
AlphaFold Q99L00
Predicted Effect probably null
Transcript: ENSMUST00000035960
SMART Domains Protein: ENSMUSP00000040802
Gene: ENSMUSG00000035439

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
coiled coil region 164 201 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035960
SMART Domains Protein: ENSMUSP00000040802
Gene: ENSMUSG00000035439

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
coiled coil region 164 201 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110071
SMART Domains Protein: ENSMUSP00000105698
Gene: ENSMUSG00000035439

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
coiled coil region 163 200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110071
SMART Domains Protein: ENSMUSP00000105698
Gene: ENSMUSG00000035439

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
coiled coil region 163 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123495
SMART Domains Protein: ENSMUSP00000123517
Gene: ENSMUSG00000035439

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144726
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HAUS8 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]; Uehara et al., 2009 [PubMed 19369198]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 64,208,569 (GRCm39) probably null Het
Agbl4 T G 4: 111,383,798 (GRCm39) S218A probably benign Het
Apol11b T C 15: 77,522,153 (GRCm39) E48G probably damaging Het
Atp4a T A 7: 30,419,666 (GRCm39) N676K probably benign Het
Capn5 T A 7: 97,775,574 (GRCm39) S456C probably benign Het
Ccar1 T C 10: 62,600,161 (GRCm39) Y590C probably damaging Het
Ccdc188 G T 16: 18,037,070 (GRCm39) G283W probably damaging Het
Cd69 A G 6: 129,248,351 (GRCm39) V45A probably damaging Het
Col3a1 G T 1: 45,377,771 (GRCm39) probably benign Het
Cyb561a3 A T 19: 10,564,166 (GRCm39) T169S probably benign Het
Cyp2c39 A T 19: 39,527,397 (GRCm39) I248L probably benign Het
Cyp2j13 T C 4: 95,947,344 (GRCm39) T236A possibly damaging Het
Efs A G 14: 55,154,961 (GRCm39) V426A probably benign Het
Eme2 A G 17: 25,113,157 (GRCm39) L136S probably damaging Het
Fastkd1 T A 2: 69,535,872 (GRCm39) K312* probably null Het
Fbxl12 A G 9: 20,553,530 (GRCm39) L19P probably damaging Het
Flg2 T A 3: 93,110,913 (GRCm39) Y980* probably null Het
Fscn2 T A 11: 120,257,527 (GRCm39) I296N probably damaging Het
Gabrg3 A G 7: 56,384,835 (GRCm39) V242A probably benign Het
Galk2 A G 2: 125,817,315 (GRCm39) H368R probably damaging Het
Gm12695 C T 4: 96,657,893 (GRCm39) S92N probably benign Het
Gpalpp1 A T 14: 76,336,031 (GRCm39) S196T probably benign Het
Gpld1 A T 13: 25,168,804 (GRCm39) M773L probably benign Het
Hirip3 A G 7: 126,462,038 (GRCm39) R19G probably damaging Het
Inpp4a A G 1: 37,405,247 (GRCm39) T92A probably damaging Het
Irgm2 A G 11: 58,111,218 (GRCm39) D303G probably damaging Het
Kpna2rt C A 17: 90,217,697 (GRCm39) R16S probably benign Het
Krtap5-2 T G 7: 141,728,748 (GRCm39) S311R unknown Het
Krtdap T A 7: 30,489,185 (GRCm39) probably null Het
Lce1g G T 3: 92,658,140 (GRCm39) S56Y unknown Het
Lrrn1 G A 6: 107,545,794 (GRCm39) V531I probably benign Het
Mctp2 T C 7: 71,861,358 (GRCm39) E429G probably damaging Het
Mrgpra2b T G 7: 47,113,793 (GRCm39) D287A probably damaging Het
Mterf3 T C 13: 67,076,258 (GRCm39) T150A probably damaging Het
Mtus2 A G 5: 148,014,725 (GRCm39) N506S probably benign Het
Myh15 G T 16: 48,963,313 (GRCm39) V1085L probably benign Het
Myo9a A G 9: 59,687,048 (GRCm39) N51S probably benign Het
Nlrc3 A T 16: 3,771,304 (GRCm39) L196Q probably damaging Het
Nlrp9c T A 7: 26,074,747 (GRCm39) N816I probably damaging Het
Nsun2 T C 13: 69,767,700 (GRCm39) V218A probably benign Het
Nt5dc1 T C 10: 34,189,673 (GRCm39) E339G possibly damaging Het
Or10ak14 C T 4: 118,611,331 (GRCm39) V135I probably benign Het
Or51b6b A G 7: 103,309,779 (GRCm39) V226A probably damaging Het
Or8j3c A T 2: 86,253,165 (GRCm39) L285* probably null Het
Pik3ap1 A G 19: 41,284,828 (GRCm39) I619T probably damaging Het
Plk1 A G 7: 121,759,118 (GRCm39) D118G probably benign Het
Ppat T C 5: 77,070,314 (GRCm39) D168G possibly damaging Het
Preb T C 5: 31,115,849 (GRCm39) E198G probably damaging Het
Psg21 T C 7: 18,386,378 (GRCm39) T203A possibly damaging Het
Rbm17 A G 2: 11,602,942 (GRCm39) V54A probably damaging Het
Rgma T A 7: 73,067,574 (GRCm39) D276E probably damaging Het
Ric8a T C 7: 140,439,471 (GRCm39) L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scarf1 A C 11: 75,416,854 (GRCm39) E765D probably damaging Het
Scart1 A T 7: 139,803,890 (GRCm39) N363Y possibly damaging Het
Sec14l4 G A 11: 3,990,041 (GRCm39) M113I probably benign Het
Senp1 C T 15: 97,980,165 (GRCm39) C60Y probably damaging Het
Slc22a21 T A 11: 53,842,130 (GRCm39) K549N probably benign Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Spata13 T C 14: 60,947,004 (GRCm39) M684T probably damaging Het
Spns1 T C 7: 125,969,958 (GRCm39) T481A probably damaging Het
Stag1 A G 9: 100,668,666 (GRCm39) Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 (GRCm39) V210E probably damaging Het
Tnc C T 4: 63,893,475 (GRCm39) E1604K possibly damaging Het
Tspan31 T C 10: 126,904,365 (GRCm39) D143G probably benign Het
Tspan5 T A 3: 138,603,903 (GRCm39) Y131* probably null Het
Ttc21a A G 9: 119,795,189 (GRCm39) D1070G probably damaging Het
Vmn2r26 C T 6: 124,016,708 (GRCm39) P391S probably benign Het
Vmn2r72 A G 7: 85,387,464 (GRCm39) I700T probably damaging Het
Vps13c A C 9: 67,821,102 (GRCm39) N1204T probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Haus8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Haus8 APN 8 71,708,289 (GRCm39) critical splice donor site probably null
IGL01298:Haus8 APN 8 71,705,757 (GRCm39) missense probably damaging 1.00
IGL01455:Haus8 APN 8 71,705,875 (GRCm39) missense probably benign 0.00
IGL02034:Haus8 APN 8 71,708,202 (GRCm39) missense probably damaging 1.00
IGL02112:Haus8 APN 8 71,708,205 (GRCm39) missense probably damaging 1.00
IGL02188:Haus8 APN 8 71,710,059 (GRCm39) missense probably damaging 1.00
IGL02871:Haus8 APN 8 71,709,138 (GRCm39) missense probably benign 0.00
IGL02939:Haus8 APN 8 71,708,361 (GRCm39) splice site probably benign
R0486:Haus8 UTSW 8 71,709,182 (GRCm39) missense probably benign 0.01
R0486:Haus8 UTSW 8 71,709,181 (GRCm39) missense probably damaging 1.00
R0648:Haus8 UTSW 8 71,709,174 (GRCm39) missense probably damaging 1.00
R1848:Haus8 UTSW 8 71,708,767 (GRCm39) intron probably benign
R4575:Haus8 UTSW 8 71,715,736 (GRCm39) missense probably damaging 0.99
R5294:Haus8 UTSW 8 71,708,354 (GRCm39) missense unknown
R6424:Haus8 UTSW 8 71,704,080 (GRCm39) nonsense probably null
R7231:Haus8 UTSW 8 71,705,781 (GRCm39) missense probably benign 0.00
R8071:Haus8 UTSW 8 71,708,695 (GRCm39) missense probably benign 0.24
R8815:Haus8 UTSW 8 71,705,910 (GRCm39) splice site probably benign
R9752:Haus8 UTSW 8 71,715,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCTGATGTTTCTGCCG -3'
(R):5'- GCTCCATCTTAGCCTAGCAGAC -3'

Sequencing Primer
(F):5'- ATGTTTCTGCCGGAGAAGC -3'
(R):5'- GCCTAGCAGACATGTTCTATTTG -3'
Posted On 2014-10-30