Incidental Mutation 'R2327:Vps13c'
ID245711
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
MMRRC Submission 040318-MU
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2327 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67913820 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 1204 (N1204T)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879]
Predicted Effect probably damaging
Transcript: ENSMUST00000077879
AA Change: N1204T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: N1204T

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 63,971,120 probably null Het
Agbl4 T G 4: 111,526,601 S218A probably benign Het
Apol11b T C 15: 77,637,953 E48G probably damaging Het
Atp4a T A 7: 30,720,241 N676K probably benign Het
Capn5 T A 7: 98,126,367 S456C probably benign Het
Ccar1 T C 10: 62,764,382 Y590C probably damaging Het
Ccdc188 G T 16: 18,219,206 G283W probably damaging Het
Cd163l1 A T 7: 140,223,977 N363Y possibly damaging Het
Cd69 A G 6: 129,271,388 V45A probably damaging Het
Col3a1 G T 1: 45,338,611 probably benign Het
Cyb561a3 A T 19: 10,586,802 T169S probably benign Het
Cyp2c39 A T 19: 39,538,953 I248L probably benign Het
Cyp2j13 T C 4: 96,059,107 T236A possibly damaging Het
Efs A G 14: 54,917,504 V426A probably benign Het
Eme2 A G 17: 24,894,183 L136S probably damaging Het
Fastkd1 T A 2: 69,705,528 K312* probably null Het
Fbxl12 A G 9: 20,642,234 L19P probably damaging Het
Flg2 T A 3: 93,203,606 Y980* probably null Het
Fscn2 T A 11: 120,366,701 I296N probably damaging Het
Gabrg3 A G 7: 56,735,087 V242A probably benign Het
Galk2 A G 2: 125,975,395 H368R probably damaging Het
Gm10184 C A 17: 89,910,269 R16S probably benign Het
Gm12695 C T 4: 96,769,656 S92N probably benign Het
Gpalpp1 A T 14: 76,098,591 S196T probably benign Het
Gpld1 A T 13: 24,984,821 M773L probably benign Het
Haus8 A G 8: 71,255,645 probably null Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Inpp4a A G 1: 37,366,166 T92A probably damaging Het
Irgm2 A G 11: 58,220,392 D303G probably damaging Het
Krtap5-2 T G 7: 142,175,011 S311R unknown Het
Krtdap T A 7: 30,789,760 probably null Het
Lce1g G T 3: 92,750,833 S56Y unknown Het
Lrrn1 G A 6: 107,568,833 V531I probably benign Het
Mctp2 T C 7: 72,211,610 E429G probably damaging Het
Mrgpra2b T G 7: 47,464,045 D287A probably damaging Het
Mterf3 T C 13: 66,928,194 T150A probably damaging Het
Mtus2 A G 5: 148,077,915 N506S probably benign Het
Myh15 G T 16: 49,142,950 V1085L probably benign Het
Myo9a A G 9: 59,779,765 N51S probably benign Het
Nlrc3 A T 16: 3,953,440 L196Q probably damaging Het
Nlrp9c T A 7: 26,375,322 N816I probably damaging Het
Nsun2 T C 13: 69,619,581 V218A probably benign Het
Nt5dc1 T C 10: 34,313,677 E339G possibly damaging Het
Olfr1062 A T 2: 86,422,821 L285* probably null Het
Olfr1338 C T 4: 118,754,134 V135I probably benign Het
Olfr623 A G 7: 103,660,572 V226A probably damaging Het
Pik3ap1 A G 19: 41,296,389 I619T probably damaging Het
Plk1 A G 7: 122,159,895 D118G probably benign Het
Ppat T C 5: 76,922,467 D168G possibly damaging Het
Preb T C 5: 30,958,505 E198G probably damaging Het
Psg21 T C 7: 18,652,453 T203A possibly damaging Het
Rbm17 A G 2: 11,598,131 V54A probably damaging Het
Rgma T A 7: 73,417,826 D276E probably damaging Het
Ric8a T C 7: 140,859,558 L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scarf1 A C 11: 75,526,028 E765D probably damaging Het
Sec14l4 G A 11: 4,040,041 M113I probably benign Het
Senp1 C T 15: 98,082,284 C60Y probably damaging Het
Slc22a21 T A 11: 53,951,304 K549N probably benign Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Spata13 T C 14: 60,709,555 M684T probably damaging Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Stag1 A G 9: 100,786,613 Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 V210E probably damaging Het
Tnc C T 4: 63,975,238 E1604K possibly damaging Het
Tspan31 T C 10: 127,068,496 D143G probably benign Het
Tspan5 T A 3: 138,898,142 Y131* probably null Het
Ttc21a A G 9: 119,966,123 D1070G probably damaging Het
Vmn2r26 C T 6: 124,039,749 P391S probably benign Het
Vmn2r72 A G 7: 85,738,256 I700T probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 intron probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 intron probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
R7732:Vps13c UTSW 9 67940516 missense probably damaging 0.97
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGCTGGGCAGTGACTG -3'
(R):5'- AGACACCAGACTGAACCGATTG -3'

Sequencing Primer
(F):5'- CAGTGACTGAGGATGGCC -3'
(R):5'- AGACTGAACCGATTGTGAACTC -3'
Posted On2014-10-30