Incidental Mutation 'R2327:Apol11b'
ID245728
Institutional Source Beutler Lab
Gene Symbol Apol11b
Ensembl Gene ENSMUSG00000091694
Gene Nameapolipoprotein L 11b
SynonymsA330102K04Rik
MMRRC Submission 040318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2327 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77633946-77643286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77637953 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 48 (E48G)
Ref Sequence ENSEMBL: ENSMUSP00000137890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166623] [ENSMUST00000180949] [ENSMUST00000181154] [ENSMUST00000181467]
Predicted Effect probably damaging
Transcript: ENSMUST00000166623
AA Change: E48G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129476
Gene: ENSMUSG00000091694
AA Change: E48G

DomainStartEndE-ValueType
Pfam:ApoL 30 311 8.6e-78 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180949
AA Change: E48G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137890
Gene: ENSMUSG00000091694
AA Change: E48G

DomainStartEndE-ValueType
Pfam:ApoL 29 323 5.1e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000181154
AA Change: E48G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137798
Gene: ENSMUSG00000091694
AA Change: E48G

DomainStartEndE-ValueType
Pfam:ApoL 29 76 5.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181467
SMART Domains Protein: ENSMUSP00000138009
Gene: ENSMUSG00000091694

DomainStartEndE-ValueType
Pfam:ApoL 1 144 2.3e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 63,971,120 probably null Het
Agbl4 T G 4: 111,526,601 S218A probably benign Het
Atp4a T A 7: 30,720,241 N676K probably benign Het
Capn5 T A 7: 98,126,367 S456C probably benign Het
Ccar1 T C 10: 62,764,382 Y590C probably damaging Het
Ccdc188 G T 16: 18,219,206 G283W probably damaging Het
Cd163l1 A T 7: 140,223,977 N363Y possibly damaging Het
Cd69 A G 6: 129,271,388 V45A probably damaging Het
Col3a1 G T 1: 45,338,611 probably benign Het
Cyb561a3 A T 19: 10,586,802 T169S probably benign Het
Cyp2c39 A T 19: 39,538,953 I248L probably benign Het
Cyp2j13 T C 4: 96,059,107 T236A possibly damaging Het
Efs A G 14: 54,917,504 V426A probably benign Het
Eme2 A G 17: 24,894,183 L136S probably damaging Het
Fastkd1 T A 2: 69,705,528 K312* probably null Het
Fbxl12 A G 9: 20,642,234 L19P probably damaging Het
Flg2 T A 3: 93,203,606 Y980* probably null Het
Fscn2 T A 11: 120,366,701 I296N probably damaging Het
Gabrg3 A G 7: 56,735,087 V242A probably benign Het
Galk2 A G 2: 125,975,395 H368R probably damaging Het
Gm10184 C A 17: 89,910,269 R16S probably benign Het
Gm12695 C T 4: 96,769,656 S92N probably benign Het
Gpalpp1 A T 14: 76,098,591 S196T probably benign Het
Gpld1 A T 13: 24,984,821 M773L probably benign Het
Haus8 A G 8: 71,255,645 probably null Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Inpp4a A G 1: 37,366,166 T92A probably damaging Het
Irgm2 A G 11: 58,220,392 D303G probably damaging Het
Krtap5-2 T G 7: 142,175,011 S311R unknown Het
Krtdap T A 7: 30,789,760 probably null Het
Lce1g G T 3: 92,750,833 S56Y unknown Het
Lrrn1 G A 6: 107,568,833 V531I probably benign Het
Mctp2 T C 7: 72,211,610 E429G probably damaging Het
Mrgpra2b T G 7: 47,464,045 D287A probably damaging Het
Mterf3 T C 13: 66,928,194 T150A probably damaging Het
Mtus2 A G 5: 148,077,915 N506S probably benign Het
Myh15 G T 16: 49,142,950 V1085L probably benign Het
Myo9a A G 9: 59,779,765 N51S probably benign Het
Nlrc3 A T 16: 3,953,440 L196Q probably damaging Het
Nlrp9c T A 7: 26,375,322 N816I probably damaging Het
Nsun2 T C 13: 69,619,581 V218A probably benign Het
Nt5dc1 T C 10: 34,313,677 E339G possibly damaging Het
Olfr1062 A T 2: 86,422,821 L285* probably null Het
Olfr1338 C T 4: 118,754,134 V135I probably benign Het
Olfr623 A G 7: 103,660,572 V226A probably damaging Het
Pik3ap1 A G 19: 41,296,389 I619T probably damaging Het
Plk1 A G 7: 122,159,895 D118G probably benign Het
Ppat T C 5: 76,922,467 D168G possibly damaging Het
Preb T C 5: 30,958,505 E198G probably damaging Het
Psg21 T C 7: 18,652,453 T203A possibly damaging Het
Rbm17 A G 2: 11,598,131 V54A probably damaging Het
Rgma T A 7: 73,417,826 D276E probably damaging Het
Ric8a T C 7: 140,859,558 L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scarf1 A C 11: 75,526,028 E765D probably damaging Het
Sec14l4 G A 11: 4,040,041 M113I probably benign Het
Senp1 C T 15: 98,082,284 C60Y probably damaging Het
Slc22a21 T A 11: 53,951,304 K549N probably benign Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Spata13 T C 14: 60,709,555 M684T probably damaging Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Stag1 A G 9: 100,786,613 Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 V210E probably damaging Het
Tnc C T 4: 63,975,238 E1604K possibly damaging Het
Tspan31 T C 10: 127,068,496 D143G probably benign Het
Tspan5 T A 3: 138,898,142 Y131* probably null Het
Ttc21a A G 9: 119,966,123 D1070G probably damaging Het
Vmn2r26 C T 6: 124,039,749 P391S probably benign Het
Vmn2r72 A G 7: 85,738,256 I700T probably damaging Het
Vps13c A C 9: 67,913,820 N1204T probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Apol11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01295:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01398:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01399:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01400:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01402:Apol11b APN 15 77638019 missense probably damaging 0.99
R1815:Apol11b UTSW 15 77635572 missense probably damaging 1.00
R3917:Apol11b UTSW 15 77635304 missense probably benign 0.03
R4424:Apol11b UTSW 15 77637933 critical splice donor site probably null
R4766:Apol11b UTSW 15 77634933 missense probably benign 0.00
R4804:Apol11b UTSW 15 77635266 missense probably damaging 1.00
R5440:Apol11b UTSW 15 77635593 nonsense probably null
R5600:Apol11b UTSW 15 77635088 missense probably damaging 0.97
R5866:Apol11b UTSW 15 77640547 missense probably null 0.97
R5997:Apol11b UTSW 15 77635497 missense probably benign 0.01
R6213:Apol11b UTSW 15 77638000 missense possibly damaging 0.82
R6249:Apol11b UTSW 15 77635337 missense probably benign 0.00
R6364:Apol11b UTSW 15 77638058 missense possibly damaging 0.46
R6984:Apol11b UTSW 15 77635346 missense probably benign 0.01
Z1088:Apol11b UTSW 15 77638007 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCTGGCATATTGAGCAACATC -3'
(R):5'- TGGCCAGACAATAGAGTTTCATG -3'

Sequencing Primer
(F):5'- CCAAAAGTGATTTCCAGCAGG -3'
(R):5'- ATAGAGTTTCATGGGACCCCGTAC -3'
Posted On2014-10-30