Incidental Mutation 'R2327:Senp1'
ID 245729
Institutional Source Beutler Lab
Gene Symbol Senp1
Ensembl Gene ENSMUSG00000033075
Gene Name SUMO1/sentrin specific peptidase 1
Synonyms D15Ertd528e, E330036L07Rik, 2310046A20Rik
MMRRC Submission 040318-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2327 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 97936625-97991625 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 97980165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 60 (C60Y)
Ref Sequence ENSEMBL: ENSMUSP00000046598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044189] [ENSMUST00000180657] [ENSMUST00000180716] [ENSMUST00000183105]
AlphaFold P59110
Predicted Effect probably damaging
Transcript: ENSMUST00000044189
AA Change: C60Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046598
Gene: ENSMUSG00000033075
AA Change: C60Y

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
Pfam:Peptidase_C48 460 638 1.3e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180657
AA Change: C60Y

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138056
Gene: ENSMUSG00000033075
AA Change: C60Y

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 383 401 N/A INTRINSIC
Pfam:Peptidase_C48 486 664 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180716
AA Change: C60Y

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138032
Gene: ENSMUSG00000033075
AA Change: C60Y

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181349
Predicted Effect probably benign
Transcript: ENSMUST00000183105
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cysteine protease that specifically targets members of the small ubiquitin-like modifier (SUMO) protein family. This protease regulates SUMO pathways by deconjugating sumoylated proteins. This protease also functions to process the precursor SUMO proteins into their mature form. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous mutant mice die before birth. Depending on the allele mice may exhibit placental labyrinth defects and widespread cell death or severe anemia and a defect in definitive erythropoiesis in the fetal liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 64,208,569 (GRCm39) probably null Het
Agbl4 T G 4: 111,383,798 (GRCm39) S218A probably benign Het
Apol11b T C 15: 77,522,153 (GRCm39) E48G probably damaging Het
Atp4a T A 7: 30,419,666 (GRCm39) N676K probably benign Het
Capn5 T A 7: 97,775,574 (GRCm39) S456C probably benign Het
Ccar1 T C 10: 62,600,161 (GRCm39) Y590C probably damaging Het
Ccdc188 G T 16: 18,037,070 (GRCm39) G283W probably damaging Het
Cd69 A G 6: 129,248,351 (GRCm39) V45A probably damaging Het
Col3a1 G T 1: 45,377,771 (GRCm39) probably benign Het
Cyb561a3 A T 19: 10,564,166 (GRCm39) T169S probably benign Het
Cyp2c39 A T 19: 39,527,397 (GRCm39) I248L probably benign Het
Cyp2j13 T C 4: 95,947,344 (GRCm39) T236A possibly damaging Het
Efs A G 14: 55,154,961 (GRCm39) V426A probably benign Het
Eme2 A G 17: 25,113,157 (GRCm39) L136S probably damaging Het
Fastkd1 T A 2: 69,535,872 (GRCm39) K312* probably null Het
Fbxl12 A G 9: 20,553,530 (GRCm39) L19P probably damaging Het
Flg2 T A 3: 93,110,913 (GRCm39) Y980* probably null Het
Fscn2 T A 11: 120,257,527 (GRCm39) I296N probably damaging Het
Gabrg3 A G 7: 56,384,835 (GRCm39) V242A probably benign Het
Galk2 A G 2: 125,817,315 (GRCm39) H368R probably damaging Het
Gm12695 C T 4: 96,657,893 (GRCm39) S92N probably benign Het
Gpalpp1 A T 14: 76,336,031 (GRCm39) S196T probably benign Het
Gpld1 A T 13: 25,168,804 (GRCm39) M773L probably benign Het
Haus8 A G 8: 71,708,289 (GRCm39) probably null Het
Hirip3 A G 7: 126,462,038 (GRCm39) R19G probably damaging Het
Inpp4a A G 1: 37,405,247 (GRCm39) T92A probably damaging Het
Irgm2 A G 11: 58,111,218 (GRCm39) D303G probably damaging Het
Kpna2rt C A 17: 90,217,697 (GRCm39) R16S probably benign Het
Krtap5-2 T G 7: 141,728,748 (GRCm39) S311R unknown Het
Krtdap T A 7: 30,489,185 (GRCm39) probably null Het
Lce1g G T 3: 92,658,140 (GRCm39) S56Y unknown Het
Lrrn1 G A 6: 107,545,794 (GRCm39) V531I probably benign Het
Mctp2 T C 7: 71,861,358 (GRCm39) E429G probably damaging Het
Mrgpra2b T G 7: 47,113,793 (GRCm39) D287A probably damaging Het
Mterf3 T C 13: 67,076,258 (GRCm39) T150A probably damaging Het
Mtus2 A G 5: 148,014,725 (GRCm39) N506S probably benign Het
Myh15 G T 16: 48,963,313 (GRCm39) V1085L probably benign Het
Myo9a A G 9: 59,687,048 (GRCm39) N51S probably benign Het
Nlrc3 A T 16: 3,771,304 (GRCm39) L196Q probably damaging Het
Nlrp9c T A 7: 26,074,747 (GRCm39) N816I probably damaging Het
Nsun2 T C 13: 69,767,700 (GRCm39) V218A probably benign Het
Nt5dc1 T C 10: 34,189,673 (GRCm39) E339G possibly damaging Het
Or10ak14 C T 4: 118,611,331 (GRCm39) V135I probably benign Het
Or51b6b A G 7: 103,309,779 (GRCm39) V226A probably damaging Het
Or8j3c A T 2: 86,253,165 (GRCm39) L285* probably null Het
Pik3ap1 A G 19: 41,284,828 (GRCm39) I619T probably damaging Het
Plk1 A G 7: 121,759,118 (GRCm39) D118G probably benign Het
Ppat T C 5: 77,070,314 (GRCm39) D168G possibly damaging Het
Preb T C 5: 31,115,849 (GRCm39) E198G probably damaging Het
Psg21 T C 7: 18,386,378 (GRCm39) T203A possibly damaging Het
Rbm17 A G 2: 11,602,942 (GRCm39) V54A probably damaging Het
Rgma T A 7: 73,067,574 (GRCm39) D276E probably damaging Het
Ric8a T C 7: 140,439,471 (GRCm39) L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scarf1 A C 11: 75,416,854 (GRCm39) E765D probably damaging Het
Scart1 A T 7: 139,803,890 (GRCm39) N363Y possibly damaging Het
Sec14l4 G A 11: 3,990,041 (GRCm39) M113I probably benign Het
Slc22a21 T A 11: 53,842,130 (GRCm39) K549N probably benign Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Spata13 T C 14: 60,947,004 (GRCm39) M684T probably damaging Het
Spns1 T C 7: 125,969,958 (GRCm39) T481A probably damaging Het
Stag1 A G 9: 100,668,666 (GRCm39) Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 (GRCm39) V210E probably damaging Het
Tnc C T 4: 63,893,475 (GRCm39) E1604K possibly damaging Het
Tspan31 T C 10: 126,904,365 (GRCm39) D143G probably benign Het
Tspan5 T A 3: 138,603,903 (GRCm39) Y131* probably null Het
Ttc21a A G 9: 119,795,189 (GRCm39) D1070G probably damaging Het
Vmn2r26 C T 6: 124,016,708 (GRCm39) P391S probably benign Het
Vmn2r72 A G 7: 85,387,464 (GRCm39) I700T probably damaging Het
Vps13c A C 9: 67,821,102 (GRCm39) N1204T probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Senp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Senp1 APN 15 97,962,719 (GRCm39) missense probably damaging 1.00
IGL01431:Senp1 APN 15 97,980,144 (GRCm39) missense probably damaging 0.97
IGL02674:Senp1 APN 15 97,954,840 (GRCm39) missense probably damaging 0.99
IGL03289:Senp1 APN 15 97,982,926 (GRCm39) missense probably damaging 1.00
Calmate UTSW 15 97,964,379 (GRCm39) missense probably benign 0.00
mustard UTSW 15 97,946,152 (GRCm39) missense probably damaging 1.00
nitrogen UTSW 15 97,964,412 (GRCm39) missense possibly damaging 0.61
Sinapis UTSW 15 97,962,761 (GRCm39) splice site probably benign
PIT1430001:Senp1 UTSW 15 97,982,870 (GRCm39) missense probably damaging 1.00
R0026:Senp1 UTSW 15 97,974,549 (GRCm39) missense probably damaging 0.99
R0026:Senp1 UTSW 15 97,974,549 (GRCm39) missense probably damaging 0.99
R0125:Senp1 UTSW 15 97,946,112 (GRCm39) missense probably damaging 0.99
R0531:Senp1 UTSW 15 97,962,761 (GRCm39) splice site probably benign
R1389:Senp1 UTSW 15 97,973,734 (GRCm39) missense probably benign 0.03
R1396:Senp1 UTSW 15 97,974,435 (GRCm39) missense probably benign 0.01
R1786:Senp1 UTSW 15 97,973,848 (GRCm39) missense probably benign 0.00
R1999:Senp1 UTSW 15 97,956,196 (GRCm39) missense possibly damaging 0.61
R2045:Senp1 UTSW 15 97,957,825 (GRCm39) missense possibly damaging 0.57
R2130:Senp1 UTSW 15 97,973,848 (GRCm39) missense probably benign 0.00
R2132:Senp1 UTSW 15 97,973,848 (GRCm39) missense probably benign 0.00
R2133:Senp1 UTSW 15 97,973,848 (GRCm39) missense probably benign 0.00
R2150:Senp1 UTSW 15 97,956,196 (GRCm39) missense possibly damaging 0.61
R3815:Senp1 UTSW 15 97,954,713 (GRCm39) missense probably damaging 1.00
R4719:Senp1 UTSW 15 97,954,731 (GRCm39) missense probably benign 0.42
R4766:Senp1 UTSW 15 97,943,777 (GRCm39) missense probably damaging 0.98
R4866:Senp1 UTSW 15 97,964,729 (GRCm39) missense possibly damaging 0.93
R5141:Senp1 UTSW 15 97,974,488 (GRCm39) missense probably benign 0.08
R5485:Senp1 UTSW 15 97,964,377 (GRCm39) missense probably benign 0.00
R5651:Senp1 UTSW 15 97,974,498 (GRCm39) missense probably benign
R5668:Senp1 UTSW 15 97,946,236 (GRCm39) missense probably damaging 1.00
R5729:Senp1 UTSW 15 97,964,412 (GRCm39) missense possibly damaging 0.61
R6041:Senp1 UTSW 15 97,956,097 (GRCm39) missense probably damaging 0.97
R6395:Senp1 UTSW 15 97,946,074 (GRCm39) missense probably damaging 1.00
R6521:Senp1 UTSW 15 97,946,152 (GRCm39) missense probably damaging 1.00
R7070:Senp1 UTSW 15 97,980,187 (GRCm39) missense possibly damaging 0.66
R7075:Senp1 UTSW 15 97,956,207 (GRCm39) missense probably benign 0.00
R7262:Senp1 UTSW 15 97,964,379 (GRCm39) missense probably benign 0.00
R7625:Senp1 UTSW 15 97,964,679 (GRCm39) missense probably benign 0.10
R8318:Senp1 UTSW 15 97,962,748 (GRCm39) missense probably damaging 1.00
R8368:Senp1 UTSW 15 97,943,255 (GRCm39) missense probably damaging 1.00
R8946:Senp1 UTSW 15 97,940,782 (GRCm39) missense probably damaging 0.96
R9373:Senp1 UTSW 15 97,964,435 (GRCm39) missense probably benign 0.00
R9650:Senp1 UTSW 15 97,946,248 (GRCm39) missense probably damaging 1.00
R9756:Senp1 UTSW 15 97,957,806 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCATGTTGCTTTTGACAATGC -3'
(R):5'- CACTGAAATCCGAGTCATTTCCTG -3'

Sequencing Primer
(F):5'- ACAAGAGGTAAGCACTCTAGCACTG -3'
(R):5'- ATGTCTTTTTCTTGTTAGAATGCAGG -3'
Posted On 2014-10-30