Incidental Mutation 'R2327:Eme2'
ID 245733
Institutional Source Beutler Lab
Gene Symbol Eme2
Ensembl Gene ENSMUSG00000073436
Gene Name essential meiotic structure-specific endonuclease subunit 2
Synonyms 2810013J18Rik
MMRRC Submission 040318-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R2327 (G1)
Quality Score 193
Status Not validated
Chromosome 17
Chromosomal Location 25111126-25114061 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25113157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 136 (L136S)
Ref Sequence ENSEMBL: ENSMUSP00000113167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024976] [ENSMUST00000024978] [ENSMUST00000043907] [ENSMUST00000068508] [ENSMUST00000088345] [ENSMUST00000115228] [ENSMUST00000121542] [ENSMUST00000119848] [ENSMUST00000120943] [ENSMUST00000119115] [ENSMUST00000115229] [ENSMUST00000121723] [ENSMUST00000119829] [ENSMUST00000117890] [ENSMUST00000120035] [ENSMUST00000117509] [ENSMUST00000121787] [ENSMUST00000178969] [ENSMUST00000154236] [ENSMUST00000146923] [ENSMUST00000168265] [ENSMUST00000139754] [ENSMUST00000144430] [ENSMUST00000130194]
AlphaFold Q56A04
Predicted Effect probably benign
Transcript: ENSMUST00000024976
SMART Domains Protein: ENSMUSP00000024976
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Pfam:SPRY 181 304 5.7e-18 PFAM
SOCS_box 309 347 2.8e0 SMART
low complexity region 364 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024978
SMART Domains Protein: ENSMUSP00000024978
Gene: ENSMUSG00000073435

DomainStartEndE-ValueType
NDK 21 158 1.06e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043907
SMART Domains Protein: ENSMUSP00000045111
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:MRP-S34 61 187 5.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068508
SMART Domains Protein: ENSMUSP00000068567
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 252 1.3e-13 PFAM
low complexity region 295 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088345
SMART Domains Protein: ENSMUSP00000085683
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115228
SMART Domains Protein: ENSMUSP00000110883
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 411 466 7e-20 PDB
low complexity region 567 581 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
SCOP:d1flga_ 972 1152 3e-8 SMART
Blast:WD40 1060 1101 6e-18 BLAST
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121542
AA Change: L136S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113936
Gene: ENSMUSG00000073436
AA Change: L136S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 1.4e-23 SMART
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119848
AA Change: L136S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113167
Gene: ENSMUSG00000073436
AA Change: L136S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 8.51e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125532
Predicted Effect probably benign
Transcript: ENSMUST00000120943
SMART Domains Protein: ENSMUSP00000112492
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119115
SMART Domains Protein: ENSMUSP00000112955
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.3e-72 PFAM
low complexity region 229 238 N/A INTRINSIC
PDB:2W83|D 385 440 7e-20 PDB
coiled coil region 493 523 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 861 869 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
SCOP:d1flga_ 955 1135 3e-8 SMART
Blast:WD40 1043 1084 5e-18 BLAST
low complexity region 1228 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115229
SMART Domains Protein: ENSMUSP00000110884
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 184 2.9e-60 PFAM
low complexity region 244 257 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:JIP_LZII 423 493 3.1e-32 PFAM
coiled coil region 533 563 N/A INTRINSIC
low complexity region 590 604 N/A INTRINSIC
low complexity region 762 777 N/A INTRINSIC
low complexity region 901 909 N/A INTRINSIC
low complexity region 936 948 N/A INTRINSIC
SCOP:d1flga_ 995 1175 4e-8 SMART
Blast:WD40 1083 1124 7e-18 BLAST
low complexity region 1268 1284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121723
SMART Domains Protein: ENSMUSP00000113698
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1e-72 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 386 441 7e-20 PDB
coiled coil region 494 524 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 862 870 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
SCOP:d1flga_ 956 1136 3e-8 SMART
Blast:WD40 1044 1085 5e-18 BLAST
low complexity region 1229 1245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119829
SMART Domains Protein: ENSMUSP00000112589
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 294 6.9e-16 PFAM
SOCS_box 299 337 2.8e0 SMART
low complexity region 354 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117890
SMART Domains Protein: ENSMUSP00000112380
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120035
SMART Domains Protein: ENSMUSP00000114084
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 235 248 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
PDB:2W83|D 416 471 6e-20 PDB
coiled coil region 524 554 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 892 900 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
SCOP:d1flga_ 986 1166 3e-8 SMART
Blast:WD40 1074 1115 6e-18 BLAST
low complexity region 1259 1275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117509
SMART Domains Protein: ENSMUSP00000112712
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 238 247 N/A INTRINSIC
PDB:2W83|D 394 449 7e-20 PDB
coiled coil region 502 532 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 731 746 N/A INTRINSIC
low complexity region 870 878 N/A INTRINSIC
low complexity region 905 917 N/A INTRINSIC
SCOP:d1flga_ 964 1144 3e-8 SMART
Blast:WD40 1052 1093 6e-18 BLAST
low complexity region 1237 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121787
SMART Domains Protein: ENSMUSP00000113753
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 3.8e-73 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 380 435 8e-20 PDB
coiled coil region 488 518 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 856 864 N/A INTRINSIC
low complexity region 891 903 N/A INTRINSIC
SCOP:d1flga_ 950 1130 3e-8 SMART
Blast:WD40 1038 1079 6e-18 BLAST
low complexity region 1223 1239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140688
Predicted Effect probably benign
Transcript: ENSMUST00000178969
SMART Domains Protein: ENSMUSP00000136924
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.1e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 3e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154236
SMART Domains Protein: ENSMUSP00000120985
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
Blast:NDK 172 208 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000146923
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168265
SMART Domains Protein: ENSMUSP00000126878
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
Pfam:SPRY 294 416 5.8e-20 PFAM
SOCS_box 420 458 2.8e0 SMART
low complexity region 475 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139754
SMART Domains Protein: ENSMUSP00000118245
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144430
SMART Domains Protein: ENSMUSP00000117226
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130194
SMART Domains Protein: ENSMUSP00000119896
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] EME2 forms a heterodimer with MUS81 (MIM 606591) that functions as an XPF (MIM 278760)-type flap/fork endonuclease in DNA repair (Ciccia et al., 2007 [PubMed 17289582]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 64,208,569 (GRCm39) probably null Het
Agbl4 T G 4: 111,383,798 (GRCm39) S218A probably benign Het
Apol11b T C 15: 77,522,153 (GRCm39) E48G probably damaging Het
Atp4a T A 7: 30,419,666 (GRCm39) N676K probably benign Het
Capn5 T A 7: 97,775,574 (GRCm39) S456C probably benign Het
Ccar1 T C 10: 62,600,161 (GRCm39) Y590C probably damaging Het
Ccdc188 G T 16: 18,037,070 (GRCm39) G283W probably damaging Het
Cd69 A G 6: 129,248,351 (GRCm39) V45A probably damaging Het
Col3a1 G T 1: 45,377,771 (GRCm39) probably benign Het
Cyb561a3 A T 19: 10,564,166 (GRCm39) T169S probably benign Het
Cyp2c39 A T 19: 39,527,397 (GRCm39) I248L probably benign Het
Cyp2j13 T C 4: 95,947,344 (GRCm39) T236A possibly damaging Het
Efs A G 14: 55,154,961 (GRCm39) V426A probably benign Het
Fastkd1 T A 2: 69,535,872 (GRCm39) K312* probably null Het
Fbxl12 A G 9: 20,553,530 (GRCm39) L19P probably damaging Het
Flg2 T A 3: 93,110,913 (GRCm39) Y980* probably null Het
Fscn2 T A 11: 120,257,527 (GRCm39) I296N probably damaging Het
Gabrg3 A G 7: 56,384,835 (GRCm39) V242A probably benign Het
Galk2 A G 2: 125,817,315 (GRCm39) H368R probably damaging Het
Gm12695 C T 4: 96,657,893 (GRCm39) S92N probably benign Het
Gpalpp1 A T 14: 76,336,031 (GRCm39) S196T probably benign Het
Gpld1 A T 13: 25,168,804 (GRCm39) M773L probably benign Het
Haus8 A G 8: 71,708,289 (GRCm39) probably null Het
Hirip3 A G 7: 126,462,038 (GRCm39) R19G probably damaging Het
Inpp4a A G 1: 37,405,247 (GRCm39) T92A probably damaging Het
Irgm2 A G 11: 58,111,218 (GRCm39) D303G probably damaging Het
Kpna2rt C A 17: 90,217,697 (GRCm39) R16S probably benign Het
Krtap5-2 T G 7: 141,728,748 (GRCm39) S311R unknown Het
Krtdap T A 7: 30,489,185 (GRCm39) probably null Het
Lce1g G T 3: 92,658,140 (GRCm39) S56Y unknown Het
Lrrn1 G A 6: 107,545,794 (GRCm39) V531I probably benign Het
Mctp2 T C 7: 71,861,358 (GRCm39) E429G probably damaging Het
Mrgpra2b T G 7: 47,113,793 (GRCm39) D287A probably damaging Het
Mterf3 T C 13: 67,076,258 (GRCm39) T150A probably damaging Het
Mtus2 A G 5: 148,014,725 (GRCm39) N506S probably benign Het
Myh15 G T 16: 48,963,313 (GRCm39) V1085L probably benign Het
Myo9a A G 9: 59,687,048 (GRCm39) N51S probably benign Het
Nlrc3 A T 16: 3,771,304 (GRCm39) L196Q probably damaging Het
Nlrp9c T A 7: 26,074,747 (GRCm39) N816I probably damaging Het
Nsun2 T C 13: 69,767,700 (GRCm39) V218A probably benign Het
Nt5dc1 T C 10: 34,189,673 (GRCm39) E339G possibly damaging Het
Or10ak14 C T 4: 118,611,331 (GRCm39) V135I probably benign Het
Or51b6b A G 7: 103,309,779 (GRCm39) V226A probably damaging Het
Or8j3c A T 2: 86,253,165 (GRCm39) L285* probably null Het
Pik3ap1 A G 19: 41,284,828 (GRCm39) I619T probably damaging Het
Plk1 A G 7: 121,759,118 (GRCm39) D118G probably benign Het
Ppat T C 5: 77,070,314 (GRCm39) D168G possibly damaging Het
Preb T C 5: 31,115,849 (GRCm39) E198G probably damaging Het
Psg21 T C 7: 18,386,378 (GRCm39) T203A possibly damaging Het
Rbm17 A G 2: 11,602,942 (GRCm39) V54A probably damaging Het
Rgma T A 7: 73,067,574 (GRCm39) D276E probably damaging Het
Ric8a T C 7: 140,439,471 (GRCm39) L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scarf1 A C 11: 75,416,854 (GRCm39) E765D probably damaging Het
Scart1 A T 7: 139,803,890 (GRCm39) N363Y possibly damaging Het
Sec14l4 G A 11: 3,990,041 (GRCm39) M113I probably benign Het
Senp1 C T 15: 97,980,165 (GRCm39) C60Y probably damaging Het
Slc22a21 T A 11: 53,842,130 (GRCm39) K549N probably benign Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Spata13 T C 14: 60,947,004 (GRCm39) M684T probably damaging Het
Spns1 T C 7: 125,969,958 (GRCm39) T481A probably damaging Het
Stag1 A G 9: 100,668,666 (GRCm39) Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 (GRCm39) V210E probably damaging Het
Tnc C T 4: 63,893,475 (GRCm39) E1604K possibly damaging Het
Tspan31 T C 10: 126,904,365 (GRCm39) D143G probably benign Het
Tspan5 T A 3: 138,603,903 (GRCm39) Y131* probably null Het
Ttc21a A G 9: 119,795,189 (GRCm39) D1070G probably damaging Het
Vmn2r26 C T 6: 124,016,708 (GRCm39) P391S probably benign Het
Vmn2r72 A G 7: 85,387,464 (GRCm39) I700T probably damaging Het
Vps13c A C 9: 67,821,102 (GRCm39) N1204T probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Eme2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Eme2 APN 17 25,112,320 (GRCm39) missense possibly damaging 0.53
R0930:Eme2 UTSW 17 25,111,892 (GRCm39) missense probably damaging 1.00
R1163:Eme2 UTSW 17 25,111,892 (GRCm39) missense probably damaging 1.00
R1302:Eme2 UTSW 17 25,111,892 (GRCm39) missense probably damaging 1.00
R1386:Eme2 UTSW 17 25,111,892 (GRCm39) missense probably damaging 1.00
R1398:Eme2 UTSW 17 25,111,892 (GRCm39) missense probably damaging 1.00
R1522:Eme2 UTSW 17 25,111,892 (GRCm39) missense probably damaging 1.00
R1762:Eme2 UTSW 17 25,112,367 (GRCm39) missense probably benign 0.00
R4410:Eme2 UTSW 17 25,112,598 (GRCm39) missense probably benign 0.05
R4635:Eme2 UTSW 17 25,113,882 (GRCm39) missense probably benign 0.12
R7285:Eme2 UTSW 17 25,113,543 (GRCm39) critical splice donor site probably null
R7315:Eme2 UTSW 17 25,113,840 (GRCm39) missense probably damaging 1.00
R7316:Eme2 UTSW 17 25,113,840 (GRCm39) missense probably damaging 1.00
R8112:Eme2 UTSW 17 25,113,809 (GRCm39) missense probably damaging 1.00
R8687:Eme2 UTSW 17 25,113,813 (GRCm39) missense possibly damaging 0.84
R9258:Eme2 UTSW 17 25,112,053 (GRCm39) missense probably damaging 1.00
R9285:Eme2 UTSW 17 25,108,132 (GRCm39) intron probably benign
R9517:Eme2 UTSW 17 25,114,033 (GRCm39) unclassified probably benign
Z1088:Eme2 UTSW 17 25,113,541 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGGCTTTCTCATCTCAC -3'
(R):5'- AACCTCCTGTTGGCAATGAGG -3'

Sequencing Primer
(F):5'- TCACCCTCAACACCTTGATG -3'
(R):5'- GTATTCAGGGACTTCTAGGGAAC -3'
Posted On 2014-10-30