Incidental Mutation 'R2328:Snapc3'
ID245750
Institutional Source Beutler Lab
Gene Symbol Snapc3
Ensembl Gene ENSMUSG00000028483
Gene Namesmall nuclear RNA activating complex, polypeptide 3
Synonyms4930558A07Rik, E030018J20Rik, 5031401C21Rik, 1810020H02Rik
MMRRC Submission 040319-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R2328 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location83417724-83467676 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 83435277 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 184 (Y184*)
Ref Sequence ENSEMBL: ENSMUSP00000123793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030206] [ENSMUST00000071544] [ENSMUST00000123262] [ENSMUST00000124856] [ENSMUST00000137512] [ENSMUST00000143533]
Predicted Effect probably null
Transcript: ENSMUST00000030206
AA Change: Y184*
SMART Domains Protein: ENSMUSP00000030206
Gene: ENSMUSG00000028483
AA Change: Y184*

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 198 401 6.5e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000071544
AA Change: Y184*
SMART Domains Protein: ENSMUSP00000102842
Gene: ENSMUSG00000028483
AA Change: Y184*

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 269 3.2e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123262
AA Change: Y184*
SMART Domains Protein: ENSMUSP00000124038
Gene: ENSMUSG00000028483
AA Change: Y184*

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124856
AA Change: Y184*
SMART Domains Protein: ENSMUSP00000124181
Gene: ENSMUSG00000028483
AA Change: Y184*

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137512
Predicted Effect probably null
Transcript: ENSMUST00000143533
AA Change: Y184*
SMART Domains Protein: ENSMUSP00000123793
Gene: ENSMUSG00000028483
AA Change: Y184*

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,455,932 Y322F probably benign Het
Abca5 T C 11: 110,276,521 T1490A probably damaging Het
Akap1 A G 11: 88,845,044 V264A possibly damaging Het
Cggbp1 A G 16: 64,856,003 D144G probably benign Het
Cubn C A 2: 13,404,080 G1352* probably null Het
Cyfip1 T A 7: 55,894,991 M457K possibly damaging Het
Dag1 T C 9: 108,209,252 N230S probably damaging Het
Dbh T C 2: 27,165,730 V72A probably benign Het
Dnah11 A G 12: 117,886,686 S4218P probably damaging Het
Dnah8 A T 17: 30,794,744 I3820F probably damaging Het
Erbb3 C T 10: 128,583,693 C186Y probably damaging Het
Foxd1 T C 13: 98,355,152 I178T probably damaging Het
Gpc5 C T 14: 115,788,179 R470W probably damaging Het
Hace1 G T 10: 45,648,945 R269L probably benign Het
Inpp5a A T 7: 139,478,094 K73* probably null Het
Olfr976 A G 9: 39,956,900 F24L possibly damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pzp T C 6: 128,510,390 I504V possibly damaging Het
Scgb1b19 T A 7: 33,288,486 C93S probably damaging Het
Setx TGTGG T 2: 29,154,060 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slamf6 G A 1: 171,934,251 V80I probably benign Het
Spg21 T C 9: 65,486,873 I284T possibly damaging Het
Tas2r123 A T 6: 132,847,316 T59S probably benign Het
Trip11 T G 12: 101,878,827 *139C probably null Het
Trp53inp1 T C 4: 11,164,495 V13A probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Ydjc A G 16: 17,147,122 E47G possibly damaging Het
Zc3h6 A G 2: 128,993,202 D86G possibly damaging Het
Other mutations in Snapc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Snapc3 APN 4 83436396 missense probably damaging 0.97
IGL01400:Snapc3 APN 4 83450177 missense probably damaging 1.00
IGL02031:Snapc3 APN 4 83417976 missense probably benign 0.04
IGL02475:Snapc3 APN 4 83450096 missense probably benign 0.04
IGL03141:Snapc3 APN 4 83435286 missense probably damaging 1.00
R0417:Snapc3 UTSW 4 83450162 missense probably benign 0.41
R0628:Snapc3 UTSW 4 83450160 missense probably benign 0.01
R0631:Snapc3 UTSW 4 83417802 missense probably damaging 0.99
R0647:Snapc3 UTSW 4 83450229 missense probably damaging 1.00
R4454:Snapc3 UTSW 4 83418759 missense probably damaging 1.00
R4860:Snapc3 UTSW 4 83464897 intron probably benign
R6497:Snapc3 UTSW 4 83453126 nonsense probably null
R6762:Snapc3 UTSW 4 83435258 missense probably damaging 1.00
R7325:Snapc3 UTSW 4 83435270 missense probably benign 0.04
R7599:Snapc3 UTSW 4 83417836 nonsense probably null
R7880:Snapc3 UTSW 4 83435194 missense probably damaging 1.00
R7963:Snapc3 UTSW 4 83435194 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACCCAAGGTTGACTGGAG -3'
(R):5'- TACTGCAAAGTCAGCTACAAGC -3'

Sequencing Primer
(F):5'- AAGGTTGACTGGAGTCCTCAC -3'
(R):5'- CAATGAACTCACAAATACATCTTGTC -3'
Posted On2014-10-30