Mutagenetix > Incidental Mutations

Incidental Mutation 'R2328:Gpc5'

245772

Institutional Source

Beutler Lab

Gene Symbol

Gpc5

Ensembl Gene

ENSMUSG00000022112

Gene Name

glypican 5

Synonyms

A230034F01Rik

MMRRC Submission

040319-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2328 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115092215-116525179 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 115788179 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 470 (R470W)

Ref Sequence

ENSEMBL: ENSMUSP00000022707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000176912]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022707
AA Change: R470W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112
AA Change: R470W

Domain	Start	End	E-Value	Type
Pfam:Glypican	9	572	1.8e-182	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176344

Predicted Effect

probably damaging
Transcript: ENSMUST00000176912
AA Change: R543W

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112
AA Change: R543W

Domain	Start	End	E-Value	Type
Pfam:Glypican	85	642	1.6e-174	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl3	T	A	4: 144,455,932	Y322F	probably benign	Het
Abca5	T	C	11: 110,276,521	T1490A	probably damaging	Het
Akap1	A	G	11: 88,845,044	V264A	possibly damaging	Het
Cggbp1	A	G	16: 64,856,003	D144G	probably benign	Het
Cubn	C	A	2: 13,404,080	G1352*	probably null	Het
Cyfip1	T	A	7: 55,894,991	M457K	possibly damaging	Het
Dag1	T	C	9: 108,209,252	N230S	probably damaging	Het
Dbh	T	C	2: 27,165,730	V72A	probably benign	Het
Dnah11	A	G	12: 117,886,686	S4218P	probably damaging	Het
Dnah8	A	T	17: 30,794,744	I3820F	probably damaging	Het
Erbb3	C	T	10: 128,583,693	C186Y	probably damaging	Het
Foxd1	T	C	13: 98,355,152	I178T	probably damaging	Het
Hace1	G	T	10: 45,648,945	R269L	probably benign	Het
Inpp5a	A	T	7: 139,478,094	K73*	probably null	Het
Olfr976	A	G	9: 39,956,900	F24L	possibly damaging	Het
Plekhm3	CCTGCTGCTGCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGCTGCTGCTGC	1: 64,937,781		probably benign	Het
Pzp	T	C	6: 128,510,390	I504V	possibly damaging	Het
Scgb1b19	T	A	7: 33,288,486	C93S	probably damaging	Het
Setx	TGTGG	T	2: 29,154,060		probably null	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slamf6	G	A	1: 171,934,251	V80I	probably benign	Het
Snapc3	T	A	4: 83,435,277	Y184*	probably null	Het
Spg21	T	C	9: 65,486,873	I284T	possibly damaging	Het
Tas2r123	A	T	6: 132,847,316	T59S	probably benign	Het
Trip11	T	G	12: 101,878,827	*139C	probably null	Het
Trp53inp1	T	C	4: 11,164,495	V13A	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Ydjc	A	G	16: 17,147,122	E47G	possibly damaging	Het
Zc3h6	A	G	2: 128,993,202	D86G	possibly damaging	Het

Other mutations in Gpc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Gpc5	APN	14	115370024	missense	probably damaging	1.00
IGL01298:Gpc5	APN	14	115399188	missense	probably benign	0.14
IGL01359:Gpc5	APN	14	115369750	missense	possibly damaging	0.74
IGL02354:Gpc5	APN	14	115133287	nonsense	probably null
IGL02361:Gpc5	APN	14	115133287	nonsense	probably null
IGL02982:Gpc5	APN	14	115369988	missense	probably damaging	1.00
IGL03120:Gpc5	APN	14	115370144	missense	possibly damaging	0.64
R0322:Gpc5	UTSW	14	115399151	missense	probably benign	0.05
R0396:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R0555:Gpc5	UTSW	14	115552328	missense	probably damaging	0.98
R0629:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R1536:Gpc5	UTSW	14	115399250	missense	probably benign	0.09
R1660:Gpc5	UTSW	14	115399279	missense	probably benign	0.12
R1676:Gpc5	UTSW	14	115370098	missense	probably damaging	1.00
R3522:Gpc5	UTSW	14	116524335	missense	probably benign	0.00
R3776:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3885:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3889:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3893:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R4041:Gpc5	UTSW	14	115133216	missense	probably damaging	1.00
R4517:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R5068:Gpc5	UTSW	14	115417264	makesense	probably null
R5639:Gpc5	UTSW	14	115092747	missense	probably benign	0.13
R5730:Gpc5	UTSW	14	115788314	missense	possibly damaging	0.73
R5944:Gpc5	UTSW	14	115369838	missense	probably benign	0.24
R6351:Gpc5	UTSW	14	115399200	missense	probably benign	0.01
R6557:Gpc5	UTSW	14	115092534	unclassified	probably benign
R6657:Gpc5	UTSW	14	115370198	missense	probably benign	0.01
R6714:Gpc5	UTSW	14	115552303	nonsense	probably null
R6751:Gpc5	UTSW	14	115369951	missense	probably benign	0.00
R7057:Gpc5	UTSW	14	115133242	missense	possibly damaging	0.64
R7142:Gpc5	UTSW	14	115417203	missense	probably benign	0.01
R7225:Gpc5	UTSW	14	115552298	missense	probably damaging	1.00
R7544:Gpc5	UTSW	14	115428173	missense	probably damaging	1.00
R7658:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R7695:Gpc5	UTSW	14	115092594	missense	unknown
R7785:Gpc5	UTSW	14	115417220	missense	probably benign	0.00
R8116:Gpc5	UTSW	14	115399225	missense	probably damaging	0.98
R8303:Gpc5	UTSW	14	115428255	missense	probably benign	0.01
RF001:Gpc5	UTSW	14	115417178	missense	probably benign	0.41
RF022:Gpc5	UTSW	14	115552276	missense	probably damaging	1.00
Z1176:Gpc5	UTSW	14	115369964	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACAAGCCAAGTAAACGGAATAGC -3'
(R):5'- GATGCTTGCACTCACAGTTTG -3'

Sequencing Primer
(F):5'- GGAATAGCCATTTTCCTCACAG -3'
(R):5'- ACAGTTTGTGATCTTCAGGGTCCTC -3'

Posted On

2014-10-30