Incidental Mutation 'R2328:Wtap'
ID245775
Institutional Source Beutler Lab
Gene Symbol Wtap
Ensembl Gene ENSMUSG00000060475
Gene NameWilms tumour 1-associating protein
Synonyms9430038B09Rik, 2810408K05Rik
MMRRC Submission 040319-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2328 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12966796-12992546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12967538 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 374 (R374Q)
Ref Sequence ENSEMBL: ENSMUSP00000124205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007007] [ENSMUST00000159551]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007007
AA Change: R374Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007007
Gene: ENSMUSG00000060475
AA Change: R374Q

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
coiled coil region 177 248 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159551
AA Change: R374Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124205
Gene: ENSMUSG00000060475
AA Change: R374Q

DomainStartEndE-ValueType
Pfam:Wtap 1 248 2.8e-157 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160654
Meta Mutation Damage Score 0.0863 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a mutation display lethality during embryogenesis with abnormalities appearing during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,455,932 Y322F probably benign Het
Abca5 T C 11: 110,276,521 T1490A probably damaging Het
Akap1 A G 11: 88,845,044 V264A possibly damaging Het
Cggbp1 A G 16: 64,856,003 D144G probably benign Het
Cubn C A 2: 13,404,080 G1352* probably null Het
Cyfip1 T A 7: 55,894,991 M457K possibly damaging Het
Dag1 T C 9: 108,209,252 N230S probably damaging Het
Dbh T C 2: 27,165,730 V72A probably benign Het
Dnah11 A G 12: 117,886,686 S4218P probably damaging Het
Dnah8 A T 17: 30,794,744 I3820F probably damaging Het
Erbb3 C T 10: 128,583,693 C186Y probably damaging Het
Foxd1 T C 13: 98,355,152 I178T probably damaging Het
Gpc5 C T 14: 115,788,179 R470W probably damaging Het
Hace1 G T 10: 45,648,945 R269L probably benign Het
Inpp5a A T 7: 139,478,094 K73* probably null Het
Olfr976 A G 9: 39,956,900 F24L possibly damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pzp T C 6: 128,510,390 I504V possibly damaging Het
Scgb1b19 T A 7: 33,288,486 C93S probably damaging Het
Setx TGTGG T 2: 29,154,060 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slamf6 G A 1: 171,934,251 V80I probably benign Het
Snapc3 T A 4: 83,435,277 Y184* probably null Het
Spg21 T C 9: 65,486,873 I284T possibly damaging Het
Tas2r123 A T 6: 132,847,316 T59S probably benign Het
Trip11 T G 12: 101,878,827 *139C probably null Het
Trp53inp1 T C 4: 11,164,495 V13A probably benign Het
Ydjc A G 16: 17,147,122 E47G possibly damaging Het
Zc3h6 A G 2: 128,993,202 D86G possibly damaging Het
Other mutations in Wtap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Wtap APN 17 12967895 missense probably benign 0.08
IGL01867:Wtap APN 17 12969455 missense probably benign 0.00
IGL02379:Wtap APN 17 12969449 missense probably benign
IGL02437:Wtap APN 17 12967733 missense probably benign
IGL02975:Wtap APN 17 12983511 missense possibly damaging 0.85
ANU22:Wtap UTSW 17 12967895 missense probably benign 0.08
R1457:Wtap UTSW 17 12981744 splice site probably null
R1799:Wtap UTSW 17 12980884 missense possibly damaging 0.96
R2240:Wtap UTSW 17 12975465 nonsense probably null
R2332:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R3426:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R4382:Wtap UTSW 17 12975420 missense probably damaging 0.99
R4703:Wtap UTSW 17 12980824 missense probably benign 0.23
R4879:Wtap UTSW 17 12969435 missense probably damaging 0.99
R4956:Wtap UTSW 17 12967536 missense probably benign 0.06
R5044:Wtap UTSW 17 12967638 missense possibly damaging 0.47
R6366:Wtap UTSW 17 12968058 splice site probably null
R6813:Wtap UTSW 17 12967510 missense probably damaging 0.96
R7324:Wtap UTSW 17 12980946 missense possibly damaging 0.91
R7443:Wtap UTSW 17 12980934 missense probably benign 0.05
R7810:Wtap UTSW 17 12980910 missense probably damaging 0.99
R7939:Wtap UTSW 17 12981796 nonsense probably null
T0970:Wtap UTSW 17 12969390 unclassified probably benign
X0067:Wtap UTSW 17 12985929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAAAGTGGCAGAGGTATTGAAG -3'
(R):5'- TAAGGCCTCCAACAGCTCAG -3'

Sequencing Primer
(F):5'- AGGAACCAAACAAAACAAAAACAC -3'
(R):5'- CTCCAACAGCTCAGAGGAGAG -3'
Posted On2014-10-30