Incidental Mutation 'R2329:Slc34a3'
ID 245781
Institutional Source Beutler Lab
Gene Symbol Slc34a3
Ensembl Gene ENSMUSG00000006469
Gene Name solute carrier family 34 (sodium phosphate), member 3
Synonyms Npt2c, NPTIIc
MMRRC Submission 040320-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.221) question?
Stock # R2329 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 25118909-25124282 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25119422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 483 (T483A)
Ref Sequence ENSEMBL: ENSMUSP00000006638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006638] [ENSMUST00000043584]
AlphaFold Q80SU6
Predicted Effect possibly damaging
Transcript: ENSMUST00000006638
AA Change: T483A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006638
Gene: ENSMUSG00000006469
AA Change: T483A

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 84 231 1.8e-25 PFAM
low complexity region 254 269 N/A INTRINSIC
Pfam:Na_Pi_cotrans 337 538 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043584
SMART Domains Protein: ENSMUSP00000042342
Gene: ENSMUSG00000036752

DomainStartEndE-ValueType
Tubulin 47 244 1.04e-67 SMART
Tubulin_C 246 383 3.89e-49 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145607
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypercalciuria, hypercalcemia and increased plasma 1,25(OH)2D3 levels but do not develop hypophosphatemia, renal calcification, rickets, or osteomalacia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,451,444 (GRCm39) S843R probably benign Het
Adamts15 G T 9: 30,813,781 (GRCm39) R795S probably damaging Het
Adora2a T A 10: 75,162,017 (GRCm39) V52E probably damaging Het
Amph T A 13: 19,323,520 (GRCm39) L594Q probably benign Het
Batf3 A T 1: 190,840,646 (GRCm39) probably null Het
Ccdc146 C T 5: 21,513,610 (GRCm39) probably null Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Csn3 A G 5: 88,077,862 (GRCm39) T123A possibly damaging Het
Cspg4 A G 9: 56,795,834 (GRCm39) T1190A probably benign Het
Dab2 C A 15: 6,459,044 (GRCm39) Q298K possibly damaging Het
Dpp6 T C 5: 27,656,286 (GRCm39) probably null Het
Efcab6 C T 15: 83,834,249 (GRCm39) R453Q possibly damaging Het
Ern2 C T 7: 121,772,710 (GRCm39) M610I possibly damaging Het
Fnip1 A G 11: 54,356,933 (GRCm39) D38G probably damaging Het
Fosb T C 7: 19,041,110 (GRCm39) T128A probably benign Het
Gad2 G A 2: 22,558,301 (GRCm39) V340M probably damaging Het
Gm19684 T A 17: 36,439,345 (GRCm39) probably benign Het
Gstk1 T A 6: 42,223,848 (GRCm39) D86E possibly damaging Het
Hus1 A G 11: 8,957,492 (GRCm39) probably null Het
Kbtbd8 T C 6: 95,103,761 (GRCm39) I547T probably benign Het
Mrpl38 T A 11: 116,022,845 (GRCm39) H373L possibly damaging Het
Nostrin A T 2: 68,991,438 (GRCm39) T144S probably damaging Het
Prl8a6 T C 13: 27,621,050 (GRCm39) H60R probably benign Het
Ros1 A G 10: 52,038,983 (GRCm39) I329T probably damaging Het
Scd2 T A 19: 44,286,492 (GRCm39) Y107* probably null Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Slc35c1 A T 2: 92,289,040 (GRCm39) Y155* probably null Het
Susd1 T C 4: 59,379,715 (GRCm39) D304G possibly damaging Het
Taf5 C T 19: 47,063,563 (GRCm39) S371L probably benign Het
Tenm4 A G 7: 96,545,069 (GRCm39) T2362A probably benign Het
Tsg101 A T 7: 46,540,868 (GRCm39) D158E probably damaging Het
Ttn G A 2: 76,599,786 (GRCm39) P19102S probably damaging Het
Ttn A G 2: 76,608,412 (GRCm39) V17837A probably damaging Het
Uhrf1 C A 17: 56,617,671 (GRCm39) probably null Het
Ulk4 C T 9: 121,101,953 (GRCm39) E42K probably damaging Het
Vmn1r184 A T 7: 25,966,387 (GRCm39) L44F probably damaging Het
Zfp932 A T 5: 110,157,406 (GRCm39) H368L probably benign Het
Other mutations in Slc34a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Slc34a3 APN 2 25,122,275 (GRCm39) missense probably benign 0.01
IGL02885:Slc34a3 APN 2 25,121,069 (GRCm39) missense probably damaging 1.00
IGL03131:Slc34a3 APN 2 25,121,246 (GRCm39) missense probably benign
IGL03166:Slc34a3 APN 2 25,122,186 (GRCm39) missense probably damaging 0.99
IGL03278:Slc34a3 APN 2 25,122,059 (GRCm39) missense probably benign 0.01
PIT4544001:Slc34a3 UTSW 2 25,120,607 (GRCm39) missense probably benign 0.27
R0415:Slc34a3 UTSW 2 25,119,122 (GRCm39) missense probably benign
R0558:Slc34a3 UTSW 2 25,123,077 (GRCm39) unclassified probably benign
R0883:Slc34a3 UTSW 2 25,121,245 (GRCm39) missense probably benign
R2107:Slc34a3 UTSW 2 25,120,999 (GRCm39) missense probably damaging 0.99
R3108:Slc34a3 UTSW 2 25,119,257 (GRCm39) missense probably benign
R4637:Slc34a3 UTSW 2 25,119,473 (GRCm39) missense possibly damaging 0.92
R5008:Slc34a3 UTSW 2 25,120,854 (GRCm39) missense possibly damaging 0.62
R5341:Slc34a3 UTSW 2 25,120,671 (GRCm39) missense probably benign 0.00
R5623:Slc34a3 UTSW 2 25,123,312 (GRCm39) splice site probably null
R6602:Slc34a3 UTSW 2 25,119,221 (GRCm39) missense probably damaging 0.99
R7512:Slc34a3 UTSW 2 25,122,253 (GRCm39) splice site probably null
R7784:Slc34a3 UTSW 2 25,122,237 (GRCm39) missense probably damaging 1.00
R8072:Slc34a3 UTSW 2 25,119,289 (GRCm39) missense probably benign 0.01
R8730:Slc34a3 UTSW 2 25,122,057 (GRCm39) missense possibly damaging 0.80
R8762:Slc34a3 UTSW 2 25,121,003 (GRCm39) missense probably benign 0.03
R8880:Slc34a3 UTSW 2 25,119,267 (GRCm39) missense probably benign 0.03
Z1176:Slc34a3 UTSW 2 25,119,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTGTTGCAGGACATTAACC -3'
(R):5'- TGAATCACTCAGCAGGACAC -3'

Sequencing Primer
(F):5'- TTGTTGCAGGACATTAACCAGGATG -3'
(R):5'- GCTTCAGACTTGACCAGAGTAG -3'
Posted On 2014-10-30