Incidental Mutation 'R2329:Csn3'
ID245790
Institutional Source Beutler Lab
Gene Symbol Csn3
Ensembl Gene ENSMUSG00000001622
Gene Namecasein kappa
SynonymsCSN10, Csnk
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2329 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87925579-87932665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87930003 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 123 (T123A)
Ref Sequence ENSEMBL: ENSMUSP00000108896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001667] [ENSMUST00000113267] [ENSMUST00000113271]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001667
AA Change: T123A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001667
Gene: ENSMUSG00000001622
AA Change: T123A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Casein_kappa 22 180 2.5e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113267
AA Change: T123A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108892
Gene: ENSMUSG00000001622
AA Change: T123A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Casein_kappa 22 181 2.7e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113271
AA Change: T123A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108896
Gene: ENSMUSG00000001622
AA Change: T123A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Casein_kappa 22 181 2.7e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190123
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display lactation failure and abnormal milk composition, but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,303,325 S843R probably benign Het
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Adora2a T A 10: 75,326,183 V52E probably damaging Het
Amph T A 13: 19,139,350 L594Q probably benign Het
Batf3 A T 1: 191,108,449 probably null Het
Ccdc146 C T 5: 21,308,612 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gm19684 T A 17: 36,128,453 probably benign Het
Gstk1 T A 6: 42,246,914 D86E possibly damaging Het
Hus1 A G 11: 9,007,492 probably null Het
Kbtbd8 T C 6: 95,126,780 I547T probably benign Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Vmn1r184 A T 7: 26,266,962 L44F probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in Csn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Csn3 APN 5 87930157 missense unknown
IGL02153:Csn3 APN 5 87930097 missense possibly damaging 0.80
IGL02936:Csn3 APN 5 87930133 missense possibly damaging 0.93
R0617:Csn3 UTSW 5 87929871 missense probably benign 0.18
R1502:Csn3 UTSW 5 87930124 missense probably damaging 0.98
R3710:Csn3 UTSW 5 87930023 missense possibly damaging 0.63
R4514:Csn3 UTSW 5 87930138 missense unknown
R5079:Csn3 UTSW 5 87929767 missense possibly damaging 0.92
R5233:Csn3 UTSW 5 87929835 missense probably benign 0.13
R5573:Csn3 UTSW 5 87930051 missense probably benign
R5913:Csn3 UTSW 5 87927611 missense probably damaging 0.99
R7175:Csn3 UTSW 5 87929727 missense probably damaging 0.98
R7577:Csn3 UTSW 5 87929962 missense not run
Predicted Primers PCR Primer
(F):5'- AAGAGTCCTGTACACACCAGTC -3'
(R):5'- AGTTGAGGACACTGGGACTG -3'

Sequencing Primer
(F):5'- CCGTCCTGAACTTCAATCAATATG -3'
(R):5'- TTGAGGACACTGGGACTGTAGTAG -3'
Posted On2014-10-30