Incidental Mutation 'R2329:Gstk1'
ID245793
Institutional Source Beutler Lab
Gene Symbol Gstk1
Ensembl Gene ENSMUSG00000029864
Gene Nameglutathione S-transferase kappa 1
Synonyms0610025I19Rik, DsbA-L
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R2329 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42245935-42250447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42246914 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 86 (D86E)
Ref Sequence ENSEMBL: ENSMUSP00000145070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031897] [ENSMUST00000204088]
Predicted Effect probably benign
Transcript: ENSMUST00000031897
AA Change: D86E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031897
Gene: ENSMUSG00000029864
AA Change: D86E

DomainStartEndE-ValueType
Pfam:DSBA 7 211 1.7e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203174
Predicted Effect possibly damaging
Transcript: ENSMUST00000204088
AA Change: D86E

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145070
Gene: ENSMUSG00000029864
AA Change: D86E

DomainStartEndE-ValueType
Pfam:DSBA 7 143 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204792
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal male survival curves associated with increased glomerular nephropathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,303,325 S843R probably benign Het
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Adora2a T A 10: 75,326,183 V52E probably damaging Het
Amph T A 13: 19,139,350 L594Q probably benign Het
Batf3 A T 1: 191,108,449 probably null Het
Ccdc146 C T 5: 21,308,612 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csn3 A G 5: 87,930,003 T123A possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gm19684 T A 17: 36,128,453 probably benign Het
Hus1 A G 11: 9,007,492 probably null Het
Kbtbd8 T C 6: 95,126,780 I547T probably benign Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Vmn1r184 A T 7: 26,266,962 L44F probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in Gstk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Gstk1 APN 6 42246626 missense possibly damaging 0.80
IGL02864:Gstk1 APN 6 42247753 missense possibly damaging 0.48
IGL03119:Gstk1 APN 6 42249899 missense probably damaging 1.00
IGL03165:Gstk1 APN 6 42249434 missense probably benign 0.02
R0033:Gstk1 UTSW 6 42246803 splice site probably benign
R1460:Gstk1 UTSW 6 42246595 missense probably damaging 1.00
R1699:Gstk1 UTSW 6 42246601 missense probably benign 0.00
R4831:Gstk1 UTSW 6 42246004 start gained probably benign
R6187:Gstk1 UTSW 6 42249860 missense possibly damaging 0.63
R7096:Gstk1 UTSW 6 42249473 missense probably damaging 1.00
R7822:Gstk1 UTSW 6 42247752 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGAGTATGCAGACCTCAGCC -3'
(R):5'- TGATATCCTATGAAAGCCTCAGC -3'

Sequencing Primer
(F):5'- GTATGCAGACCTCAGCCTAAACTAG -3'
(R):5'- AGCTGGACTGCTCTCCAC -3'
Posted On2014-10-30