Incidental Mutation 'R2329:Vmn1r184'
ID245796
Institutional Source Beutler Lab
Gene Symbol Vmn1r184
Ensembl Gene ENSMUSG00000046130
Gene Namevomeronasal 1 receptor, 184
Synonyms
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2329 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26260334-26270619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26266962 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 44 (L44F)
Ref Sequence ENSEMBL: ENSMUSP00000154576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057123] [ENSMUST00000227230] [ENSMUST00000227232] [ENSMUST00000227534] [ENSMUST00000227790] [ENSMUST00000228145] [ENSMUST00000228369]
Predicted Effect probably damaging
Transcript: ENSMUST00000057123
AA Change: L44F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061885
Gene: ENSMUSG00000046130
AA Change: L44F

DomainStartEndE-ValueType
Pfam:TAS2R 8 308 1.7e-7 PFAM
Pfam:V1R 35 297 7.5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227230
AA Change: L44F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227232
AA Change: L44F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227534
AA Change: L44F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227790
AA Change: L44F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228145
AA Change: L44F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228369
AA Change: L44F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,303,325 S843R probably benign Het
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Adora2a T A 10: 75,326,183 V52E probably damaging Het
Amph T A 13: 19,139,350 L594Q probably benign Het
Batf3 A T 1: 191,108,449 probably null Het
Ccdc146 C T 5: 21,308,612 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csn3 A G 5: 87,930,003 T123A possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gm19684 T A 17: 36,128,453 probably benign Het
Gstk1 T A 6: 42,246,914 D86E possibly damaging Het
Hus1 A G 11: 9,007,492 probably null Het
Kbtbd8 T C 6: 95,126,780 I547T probably benign Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in Vmn1r184
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Vmn1r184 APN 7 26267437 missense probably damaging 1.00
IGL01411:Vmn1r184 APN 7 26266895 missense probably benign 0.06
IGL02961:Vmn1r184 APN 7 26267650 missense probably benign 0.27
IGL03271:Vmn1r184 APN 7 26267609 missense probably benign
R0302:Vmn1r184 UTSW 7 26267543 missense probably damaging 1.00
R0384:Vmn1r184 UTSW 7 26267651 missense probably benign 0.41
R0591:Vmn1r184 UTSW 7 26267075 missense probably damaging 0.98
R0620:Vmn1r184 UTSW 7 26267177 missense possibly damaging 0.46
R1644:Vmn1r184 UTSW 7 26267245 missense probably benign 0.00
R2304:Vmn1r184 UTSW 7 26267125 missense probably damaging 1.00
R3522:Vmn1r184 UTSW 7 26267583 nonsense probably null
R5020:Vmn1r184 UTSW 7 26267530 missense possibly damaging 0.87
R5030:Vmn1r184 UTSW 7 26267456 missense probably benign 0.25
R5049:Vmn1r184 UTSW 7 26267368 missense possibly damaging 0.49
R5076:Vmn1r184 UTSW 7 26266921 missense probably benign 0.00
R5213:Vmn1r184 UTSW 7 26267711 missense probably damaging 0.99
R5554:Vmn1r184 UTSW 7 26266988 missense probably damaging 1.00
R6146:Vmn1r184 UTSW 7 26267392 missense probably benign 0.08
R6868:Vmn1r184 UTSW 7 26267302 missense probably benign 0.00
R6937:Vmn1r184 UTSW 7 26267325 missense probably benign 0.08
R6943:Vmn1r184 UTSW 7 26267138 missense possibly damaging 0.77
R7190:Vmn1r184 UTSW 7 26267680 missense probably damaging 1.00
R7239:Vmn1r184 UTSW 7 26267177 missense possibly damaging 0.79
R7472:Vmn1r184 UTSW 7 26267399 missense possibly damaging 0.82
Z1177:Vmn1r184 UTSW 7 26266990 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTAACTCGAGAAATGGTGGGG -3'
(R):5'- CAACAGGATTTTCTGGGGCTG -3'

Sequencing Primer
(F):5'- CTCGAGAAATGGTGGGGATATATTC -3'
(R):5'- GATGGTCATGGCCTGAAAAACACTC -3'
Posted On2014-10-30