Mutagenetix > Incidental Mutation

Incidental Mutation 'R2329:Ulk4'

245802

Institutional Source

Beutler Lab

Gene Symbol

Ulk4

Ensembl Gene

ENSMUSG00000040936

Gene Name

unc-51-like kinase 4

Synonyms

4932415A06Rik

MMRRC Submission

040320-MU

Accession Numbers

Genbank: NM_177589; MGI: 1921622

Essential gene?

Possibly essential (E-score: 0.622) question?

Stock #

R2329 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120955351-121277197 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 121272887 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 42 (E42K)

Ref Sequence

ENSEMBL: ENSMUSP00000131342 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051479
AA Change: E42K

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: E42K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	277	9.9e-26	PFAM
Pfam:Pkinase	4	280	4.6e-49	PFAM
low complexity region	949	964	N/A	INTRINSIC
low complexity region	968	985	N/A	INTRINSIC
low complexity region	1107	1119	N/A	INTRINSIC
low complexity region	1147	1161	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000051565
AA Change: E42K

SMART Domains

Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936
AA Change: E42K

Domain	Start	End	E-Value	Type
SCOP:d1jvpp_	1	32	9e-6	SMART
Blast:S_TKc	4	45	2e-8	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164336

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171061
AA Change: E42K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: E42K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	277	4.3e-26	PFAM
Pfam:Pkinase	4	280	2.1e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171923
AA Change: E42K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: E42K

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	153	3.1e-14	PFAM
Pfam:Pkinase	4	280	4.9e-50	PFAM
Pfam:Pkinase_Tyr	165	277	6.1e-10	PFAM
low complexity region	949	964	N/A	INTRINSIC
low complexity region	968	985	N/A	INTRINSIC
low complexity region	1107	1119	N/A	INTRINSIC
low complexity region	1147	1171	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213695

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215259

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	C	13: 77,303,325	S843R	probably benign	Het
Adamts15	G	T	9: 30,902,485	R795S	probably damaging	Het
Adora2a	T	A	10: 75,326,183	V52E	probably damaging	Het
Amph	T	A	13: 19,139,350	L594Q	probably benign	Het
Batf3	A	T	1: 191,108,449		probably null	Het
Ccdc146	C	T	5: 21,308,612		probably null	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Csn3	A	G	5: 87,930,003	T123A	possibly damaging	Het
Cspg4	A	G	9: 56,888,550	T1190A	probably benign	Het
Dab2	C	A	15: 6,429,563	Q298K	possibly damaging	Het
Dpp6	T	C	5: 27,451,288		probably null	Het
Efcab6	C	T	15: 83,950,048	R453Q	possibly damaging	Het
Ern2	C	T	7: 122,173,487	M610I	possibly damaging	Het
Fnip1	A	G	11: 54,466,107	D38G	probably damaging	Het
Fosb	T	C	7: 19,307,185	T128A	probably benign	Het
Gad2	G	A	2: 22,668,289	V340M	probably damaging	Het
Gm19684	T	A	17: 36,128,453		probably benign	Het
Gstk1	T	A	6: 42,246,914	D86E	possibly damaging	Het
Hus1	A	G	11: 9,007,492		probably null	Het
Kbtbd8	T	C	6: 95,126,780	I547T	probably benign	Het
Mrpl38	T	A	11: 116,132,019	H373L	possibly damaging	Het
Nostrin	A	T	2: 69,161,094	T144S	probably damaging	Het
Prl8a6	T	C	13: 27,437,067	H60R	probably benign	Het
Ros1	A	G	10: 52,162,887	I329T	probably damaging	Het
Scd2	T	A	19: 44,298,053	Y107*	probably null	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc34a3	T	C	2: 25,229,410	T483A	possibly damaging	Het
Slc35c1	A	T	2: 92,458,695	Y155*	probably null	Het
Susd1	T	C	4: 59,379,715	D304G	possibly damaging	Het
Taf5	C	T	19: 47,075,124	S371L	probably benign	Het
Tenm4	A	G	7: 96,895,862	T2362A	probably benign	Het
Tsg101	A	T	7: 46,891,120	D158E	probably damaging	Het
Ttn	G	A	2: 76,769,442	P19102S	probably damaging	Het
Ttn	A	G	2: 76,778,068	V17837A	probably damaging	Het
Uhrf1	C	A	17: 56,310,671		probably null	Het
Vmn1r184	A	T	7: 26,266,962	L44F	probably damaging	Het
Zfp932	A	T	5: 110,009,540	H368L	probably benign	Het

Other mutations in Ulk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01122:Ulk4	APN	9	121168292	missense	possibly damaging	0.48
IGL01345:Ulk4	APN	9	121208162	missense	possibly damaging	0.48
IGL01432:Ulk4	APN	9	121266301	missense	probably damaging	1.00
IGL01807:Ulk4	APN	9	121255185	missense	probably damaging	1.00
IGL02139:Ulk4	APN	9	121141831	splice site	probably null
IGL02266:Ulk4	APN	9	121081700	missense	probably benign	0.10
IGL02511:Ulk4	APN	9	121188354	missense	probably damaging	1.00
IGL02546:Ulk4	APN	9	121152307	nonsense	probably null
IGL02687:Ulk4	APN	9	121192662	missense	possibly damaging	0.89
IGL03220:Ulk4	APN	9	121145336	missense	probably damaging	1.00
3-1:Ulk4	UTSW	9	121255171	missense	probably benign	0.02
R0031:Ulk4	UTSW	9	121272982	missense	probably damaging	1.00
R0433:Ulk4	UTSW	9	121044819	missense	probably benign	0.27
R0513:Ulk4	UTSW	9	121152325	missense	probably benign	0.13
R0524:Ulk4	UTSW	9	121252651	critical splice donor site	probably null
R1268:Ulk4	UTSW	9	121257074	splice site	probably benign
R1439:Ulk4	UTSW	9	121266258	missense	possibly damaging	0.58
R1470:Ulk4	UTSW	9	121081656	missense	probably benign	0.00
R1470:Ulk4	UTSW	9	121081656	missense	probably benign	0.00
R1531:Ulk4	UTSW	9	121044775	missense	probably damaging	0.97
R1595:Ulk4	UTSW	9	121044838	missense	probably damaging	0.96
R1620:Ulk4	UTSW	9	121204805	missense	possibly damaging	0.81
R1835:Ulk4	UTSW	9	121168184	missense	probably null	1.00
R1966:Ulk4	UTSW	9	121257116	missense	probably benign
R2129:Ulk4	UTSW	9	121152182	missense	probably benign	0.03
R2877:Ulk4	UTSW	9	121260039	missense	probably benign	0.11
R2878:Ulk4	UTSW	9	121260039	missense	probably benign	0.11
R3734:Ulk4	UTSW	9	121261989	missense	probably benign	0.21
R3769:Ulk4	UTSW	9	121263700	missense	probably benign	0.00
R4005:Ulk4	UTSW	9	121168199	missense	possibly damaging	0.94
R4024:Ulk4	UTSW	9	121044849	missense	possibly damaging	0.86
R4321:Ulk4	UTSW	9	121073996	missense	probably benign	0.00
R4461:Ulk4	UTSW	9	121156884	missense	possibly damaging	0.83
R4537:Ulk4	UTSW	9	121263638	nonsense	probably null
R4542:Ulk4	UTSW	9	121263638	nonsense	probably null
R4572:Ulk4	UTSW	9	121192764	missense	probably damaging	1.00
R4647:Ulk4	UTSW	9	121141852	missense	probably benign	0.15
R4712:Ulk4	UTSW	9	121244370	missense	probably benign	0.23
R4730:Ulk4	UTSW	9	121263725	missense	probably benign	0.05
R4731:Ulk4	UTSW	9	121263638	nonsense	probably null
R4732:Ulk4	UTSW	9	121263638	nonsense	probably null
R4733:Ulk4	UTSW	9	121263638	nonsense	probably null
R4737:Ulk4	UTSW	9	121073872	nonsense	probably null
R4781:Ulk4	UTSW	9	121103576	missense	probably benign	0.00
R4860:Ulk4	UTSW	9	121250902	missense	possibly damaging	0.68
R4926:Ulk4	UTSW	9	121258732	missense	probably benign	0.00
R4990:Ulk4	UTSW	9	121192786	missense	probably benign	0.01
R6056:Ulk4	UTSW	9	121272955	missense	probably damaging	1.00
R6448:Ulk4	UTSW	9	121103630	missense	probably damaging	0.99
R6546:Ulk4	UTSW	9	121141894	missense	probably damaging	1.00
R6668:Ulk4	UTSW	9	121188342	missense	probably damaging	1.00
R6915:Ulk4	UTSW	9	121258820	missense	probably benign
R6929:Ulk4	UTSW	9	121074015	missense	probably benign	0.02
R7069:Ulk4	UTSW	9	121258810	missense	probably benign	0.01
R7069:Ulk4	UTSW	9	121266517	missense	probably benign	0.25
R7293:Ulk4	UTSW	9	121255124	missense	probably damaging	1.00
R7299:Ulk4	UTSW	9	121145059	missense	probably benign	0.32
R7301:Ulk4	UTSW	9	121145059	missense	probably benign	0.32
R7337:Ulk4	UTSW	9	121248927	missense	probably benign	0.44
R7395:Ulk4	UTSW	9	121255112	missense	probably benign
R7423:Ulk4	UTSW	9	121103621	missense	possibly damaging	0.48
R7545:Ulk4	UTSW	9	121141838	missense	probably benign	0.00
R7753:Ulk4	UTSW	9	121266512	critical splice donor site	probably null
R7790:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7791:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7793:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7834:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7836:Ulk4	UTSW	9	121044819	missense	possibly damaging	0.72
R7960:Ulk4	UTSW	9	121272956	missense	probably damaging	1.00
R8087:Ulk4	UTSW	9	121266251	missense	probably damaging	0.99
R8203:Ulk4	UTSW	9	121168208	missense	probably damaging	0.96
R8246:Ulk4	UTSW	9	121156875	makesense	probably null
R8430:Ulk4	UTSW	9	121257078	critical splice donor site	probably null
R8841:Ulk4	UTSW	9	121204738	missense	probably damaging	1.00
R9014:Ulk4	UTSW	9	121188228	missense	probably benign	0.00
R9092:Ulk4	UTSW	9	121073937	missense
R9126:Ulk4	UTSW	9	121261922	missense	probably damaging	0.99
R9176:Ulk4	UTSW	9	121145062	missense	probably benign
R9235:Ulk4	UTSW	9	121152151	missense	probably benign	0.13
R9713:Ulk4	UTSW	9	121044796	nonsense	probably null
X0024:Ulk4	UTSW	9	121192753	missense	probably damaging	1.00
X0066:Ulk4	UTSW	9	121262606	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGACTGTGGGTACGGAAG -3'
(R):5'- GAGCTAGACATGCTGTTTTACCG -3'

Sequencing Primer
(F):5'- ATGAAATGCTGGGCCTTGCAC -3'
(R):5'- CGTATATGAGCAGTCGATCCCAG -3'

Posted On

2014-10-30