Incidental Mutation 'R2329:Adora2a'
ID 245805
Institutional Source Beutler Lab
Gene Symbol Adora2a
Ensembl Gene ENSMUSG00000020178
Gene Name adenosine A2a receptor
Synonyms A2aR, AA2AR, A2a, Rs, A2AAR, ARA2A
MMRRC Submission 040320-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2329 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 75152711-75170618 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75162017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 52 (V52E)
Ref Sequence ENSEMBL: ENSMUSP00000101060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105420] [ENSMUST00000217703] [ENSMUST00000219044] [ENSMUST00000219322]
AlphaFold Q60613
Predicted Effect probably damaging
Transcript: ENSMUST00000105420
AA Change: V52E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101060
Gene: ENSMUSG00000020178
AA Change: V52E

DomainStartEndE-ValueType
Pfam:7tm_4 11 301 1.9e-9 PFAM
Pfam:7TM_GPCR_Srsx 14 298 5.1e-15 PFAM
Pfam:7tm_1 20 283 3.1e-62 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217703
Predicted Effect probably damaging
Transcript: ENSMUST00000219044
AA Change: V52E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000219322
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable and fertile with reduced exploratory activity and displaying depressive rather than stimulatory response to caffeine. Mutants test more anxious, were more aggressive towards intruders, and slower to respond to pain stimuli. Blood pressure and heart rate are increased, as well as platelet aggregation rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,451,444 (GRCm39) S843R probably benign Het
Adamts15 G T 9: 30,813,781 (GRCm39) R795S probably damaging Het
Amph T A 13: 19,323,520 (GRCm39) L594Q probably benign Het
Batf3 A T 1: 190,840,646 (GRCm39) probably null Het
Ccdc146 C T 5: 21,513,610 (GRCm39) probably null Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Csn3 A G 5: 88,077,862 (GRCm39) T123A possibly damaging Het
Cspg4 A G 9: 56,795,834 (GRCm39) T1190A probably benign Het
Dab2 C A 15: 6,459,044 (GRCm39) Q298K possibly damaging Het
Dpp6 T C 5: 27,656,286 (GRCm39) probably null Het
Efcab6 C T 15: 83,834,249 (GRCm39) R453Q possibly damaging Het
Ern2 C T 7: 121,772,710 (GRCm39) M610I possibly damaging Het
Fnip1 A G 11: 54,356,933 (GRCm39) D38G probably damaging Het
Fosb T C 7: 19,041,110 (GRCm39) T128A probably benign Het
Gad2 G A 2: 22,558,301 (GRCm39) V340M probably damaging Het
Gm19684 T A 17: 36,439,345 (GRCm39) probably benign Het
Gstk1 T A 6: 42,223,848 (GRCm39) D86E possibly damaging Het
Hus1 A G 11: 8,957,492 (GRCm39) probably null Het
Kbtbd8 T C 6: 95,103,761 (GRCm39) I547T probably benign Het
Mrpl38 T A 11: 116,022,845 (GRCm39) H373L possibly damaging Het
Nostrin A T 2: 68,991,438 (GRCm39) T144S probably damaging Het
Prl8a6 T C 13: 27,621,050 (GRCm39) H60R probably benign Het
Ros1 A G 10: 52,038,983 (GRCm39) I329T probably damaging Het
Scd2 T A 19: 44,286,492 (GRCm39) Y107* probably null Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Slc34a3 T C 2: 25,119,422 (GRCm39) T483A possibly damaging Het
Slc35c1 A T 2: 92,289,040 (GRCm39) Y155* probably null Het
Susd1 T C 4: 59,379,715 (GRCm39) D304G possibly damaging Het
Taf5 C T 19: 47,063,563 (GRCm39) S371L probably benign Het
Tenm4 A G 7: 96,545,069 (GRCm39) T2362A probably benign Het
Tsg101 A T 7: 46,540,868 (GRCm39) D158E probably damaging Het
Ttn G A 2: 76,599,786 (GRCm39) P19102S probably damaging Het
Ttn A G 2: 76,608,412 (GRCm39) V17837A probably damaging Het
Uhrf1 C A 17: 56,617,671 (GRCm39) probably null Het
Ulk4 C T 9: 121,101,953 (GRCm39) E42K probably damaging Het
Vmn1r184 A T 7: 25,966,387 (GRCm39) L44F probably damaging Het
Zfp932 A T 5: 110,157,406 (GRCm39) H368L probably benign Het
Other mutations in Adora2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adora2a APN 10 75,169,285 (GRCm39) missense probably damaging 0.99
IGL01298:Adora2a APN 10 75,169,326 (GRCm39) missense probably damaging 1.00
R1217:Adora2a UTSW 10 75,169,049 (GRCm39) missense probably damaging 1.00
R1983:Adora2a UTSW 10 75,169,480 (GRCm39) missense probably benign 0.04
R4808:Adora2a UTSW 10 75,169,280 (GRCm39) missense probably damaging 1.00
R4884:Adora2a UTSW 10 75,161,879 (GRCm39) missense probably null 0.99
R5056:Adora2a UTSW 10 75,161,992 (GRCm39) missense probably damaging 1.00
R5250:Adora2a UTSW 10 75,161,882 (GRCm39) missense probably damaging 1.00
R6153:Adora2a UTSW 10 75,161,981 (GRCm39) missense possibly damaging 0.78
R6306:Adora2a UTSW 10 75,169,238 (GRCm39) missense probably damaging 1.00
R6746:Adora2a UTSW 10 75,169,442 (GRCm39) missense probably benign 0.12
R7047:Adora2a UTSW 10 75,162,145 (GRCm39) missense probably damaging 1.00
R7493:Adora2a UTSW 10 75,169,423 (GRCm39) missense possibly damaging 0.92
R7792:Adora2a UTSW 10 75,169,480 (GRCm39) missense probably benign 0.00
R8824:Adora2a UTSW 10 75,162,013 (GRCm39) missense probably damaging 1.00
R8941:Adora2a UTSW 10 75,169,559 (GRCm39) nonsense probably null
RF004:Adora2a UTSW 10 75,168,988 (GRCm39) missense probably benign 0.00
X0017:Adora2a UTSW 10 75,169,397 (GRCm39) missense probably damaging 1.00
Z1176:Adora2a UTSW 10 75,169,162 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTTGTGAGGAAAGGGCTG -3'
(R):5'- CCTTATGCACAGATGTAACCCC -3'

Sequencing Primer
(F):5'- CAGCTATGGACCGAGAGCTG -3'
(R):5'- GATGTAACCCCTGGCTCAC -3'
Posted On 2014-10-30