Incidental Mutation 'R2329:Adora2a'
ID245805
Institutional Source Beutler Lab
Gene Symbol Adora2a
Ensembl Gene ENSMUSG00000020178
Gene Nameadenosine A2a receptor
SynonymsA2AAR, AA2AR, A2aR, A2a, Rs
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2329 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75316877-75334784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75326183 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 52 (V52E)
Ref Sequence ENSEMBL: ENSMUSP00000101060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105420] [ENSMUST00000217703] [ENSMUST00000219044] [ENSMUST00000219322]
Predicted Effect probably damaging
Transcript: ENSMUST00000105420
AA Change: V52E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101060
Gene: ENSMUSG00000020178
AA Change: V52E

DomainStartEndE-ValueType
Pfam:7tm_4 11 301 1.9e-9 PFAM
Pfam:7TM_GPCR_Srsx 14 298 5.1e-15 PFAM
Pfam:7tm_1 20 283 3.1e-62 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217703
Predicted Effect probably damaging
Transcript: ENSMUST00000219044
AA Change: V52E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000219322
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable and fertile with reduced exploratory activity and displaying depressive rather than stimulatory response to caffeine. Mutants test more anxious, were more aggressive towards intruders, and slower to respond to pain stimuli. Blood pressure and heart rate are increased, as well as platelet aggregation rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,303,325 S843R probably benign Het
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Amph T A 13: 19,139,350 L594Q probably benign Het
Batf3 A T 1: 191,108,449 probably null Het
Ccdc146 C T 5: 21,308,612 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csn3 A G 5: 87,930,003 T123A possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gm19684 T A 17: 36,128,453 probably benign Het
Gstk1 T A 6: 42,246,914 D86E possibly damaging Het
Hus1 A G 11: 9,007,492 probably null Het
Kbtbd8 T C 6: 95,126,780 I547T probably benign Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Vmn1r184 A T 7: 26,266,962 L44F probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in Adora2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adora2a APN 10 75333451 missense probably damaging 0.99
IGL01298:Adora2a APN 10 75333492 missense probably damaging 1.00
R1217:Adora2a UTSW 10 75333215 missense probably damaging 1.00
R1983:Adora2a UTSW 10 75333646 missense probably benign 0.04
R4808:Adora2a UTSW 10 75333446 missense probably damaging 1.00
R4884:Adora2a UTSW 10 75326045 missense probably null 0.99
R5056:Adora2a UTSW 10 75326158 missense probably damaging 1.00
R5250:Adora2a UTSW 10 75326048 missense probably damaging 1.00
R6153:Adora2a UTSW 10 75326147 missense possibly damaging 0.78
R6306:Adora2a UTSW 10 75333404 missense probably damaging 1.00
R6746:Adora2a UTSW 10 75333608 missense probably benign 0.12
R7047:Adora2a UTSW 10 75326311 missense probably damaging 1.00
R7493:Adora2a UTSW 10 75333589 missense possibly damaging 0.92
R7792:Adora2a UTSW 10 75333646 missense probably benign 0.00
RF004:Adora2a UTSW 10 75333154 missense probably benign 0.00
X0017:Adora2a UTSW 10 75333563 missense probably damaging 1.00
Z1176:Adora2a UTSW 10 75333328 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTTGTGAGGAAAGGGCTG -3'
(R):5'- CCTTATGCACAGATGTAACCCC -3'

Sequencing Primer
(F):5'- CAGCTATGGACCGAGAGCTG -3'
(R):5'- GATGTAACCCCTGGCTCAC -3'
Posted On2014-10-30