Incidental Mutation 'R2329:Amph'
ID245811
Institutional Source Beutler Lab
Gene Symbol Amph
Ensembl Gene ENSMUSG00000021314
Gene Nameamphiphysin
Synonyms
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R2329 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location18948205-19150921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19139350 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 594 (L594Q)
Ref Sequence ENSEMBL: ENSMUSP00000142766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]
Predicted Effect probably benign
Transcript: ENSMUST00000003345
AA Change: L590Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: L590Q

DomainStartEndE-ValueType
BAR 12 233 8.47e-80 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
low complexity region 479 499 N/A INTRINSIC
SH3 616 686 7.82e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197545
Predicted Effect probably benign
Transcript: ENSMUST00000200466
AA Change: L594Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: L594Q

DomainStartEndE-ValueType
BAR 12 233 2.3e-82 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 428 449 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
SH3 620 690 4.9e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222698
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,303,325 S843R probably benign Het
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Adora2a T A 10: 75,326,183 V52E probably damaging Het
Batf3 A T 1: 191,108,449 probably null Het
Ccdc146 C T 5: 21,308,612 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csn3 A G 5: 87,930,003 T123A possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gm19684 T A 17: 36,128,453 probably benign Het
Gstk1 T A 6: 42,246,914 D86E possibly damaging Het
Hus1 A G 11: 9,007,492 probably null Het
Kbtbd8 T C 6: 95,126,780 I547T probably benign Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Vmn1r184 A T 7: 26,266,962 L44F probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in Amph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Amph APN 13 19120606 missense probably damaging 1.00
IGL01866:Amph APN 13 19142002 missense probably damaging 1.00
IGL02157:Amph APN 13 19104231 missense possibly damaging 0.60
IGL02300:Amph APN 13 19086604 missense probably damaging 1.00
IGL02435:Amph APN 13 19139163 splice site probably benign
IGL03060:Amph APN 13 19094814 missense probably damaging 0.99
IGL03122:Amph APN 13 19102943 missense probably damaging 0.98
R0037:Amph UTSW 13 19100653 missense possibly damaging 0.90
R0646:Amph UTSW 13 19113116 missense possibly damaging 0.95
R0652:Amph UTSW 13 19086621 splice site probably null
R1005:Amph UTSW 13 19142028 missense probably damaging 0.97
R1006:Amph UTSW 13 19142028 missense probably damaging 0.97
R1199:Amph UTSW 13 19142028 missense probably damaging 0.97
R1200:Amph UTSW 13 19142028 missense probably damaging 0.97
R1201:Amph UTSW 13 19142028 missense probably damaging 0.97
R1333:Amph UTSW 13 19142028 missense probably damaging 0.97
R1334:Amph UTSW 13 19142028 missense probably damaging 0.97
R1335:Amph UTSW 13 19142028 missense probably damaging 0.97
R1337:Amph UTSW 13 19142028 missense probably damaging 0.97
R1338:Amph UTSW 13 19142028 missense probably damaging 0.97
R1384:Amph UTSW 13 19142028 missense probably damaging 0.97
R1397:Amph UTSW 13 19142028 missense probably damaging 0.97
R1501:Amph UTSW 13 19104291 nonsense probably null
R1528:Amph UTSW 13 19142028 missense probably damaging 0.97
R1822:Amph UTSW 13 18948455 missense probably damaging 0.98
R2004:Amph UTSW 13 19142028 missense probably damaging 0.97
R2006:Amph UTSW 13 19142028 missense probably damaging 0.97
R2061:Amph UTSW 13 19125035 nonsense probably null
R2111:Amph UTSW 13 19116266 splice site probably benign
R2878:Amph UTSW 13 19104267 missense possibly damaging 0.95
R3121:Amph UTSW 13 19113146 nonsense probably null
R3548:Amph UTSW 13 19102959 missense probably damaging 1.00
R4059:Amph UTSW 13 19141998 missense probably damaging 1.00
R4369:Amph UTSW 13 19137700 missense probably benign 0.20
R4492:Amph UTSW 13 19149758 missense possibly damaging 0.76
R4855:Amph UTSW 13 19084208 missense probably damaging 1.00
R4937:Amph UTSW 13 19104345 missense probably damaging 1.00
R4965:Amph UTSW 13 19137699 missense probably benign 0.12
R5777:Amph UTSW 13 19046016 missense probably damaging 1.00
R5787:Amph UTSW 13 18948454 missense possibly damaging 0.75
R6091:Amph UTSW 13 19125123 missense probably benign 0.01
R7100:Amph UTSW 13 19149841 makesense probably null
R7103:Amph UTSW 13 19149738 missense probably benign 0.00
R7451:Amph UTSW 13 19077368 missense probably damaging 1.00
R7522:Amph UTSW 13 19086545 missense probably damaging 0.96
V1662:Amph UTSW 13 19139370 missense probably benign 0.36
Z1177:Amph UTSW 13 19139334 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTGTCATTGAGCCAGCCTC -3'
(R):5'- GCTTCGGGTCATTTTCCCAG -3'

Sequencing Primer
(F):5'- TTGAGCCAGCCTCCAACCATG -3'
(R):5'- GACCTTGTAGAGAAAGCCA -3'
Posted On2014-10-30