Incidental Mutation 'R2329:Crygs'
ID245817
Institutional Source Beutler Lab
Gene Symbol Crygs
Ensembl Gene ENSMUSG00000033501
Gene Namecrystallin, gamma S
SynonymsOpj
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2329 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22805203-22811577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22805551 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 102 (G102D)
Ref Sequence ENSEMBL: ENSMUSP00000043588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040592]
PDB Structure
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin from joint refinement with SAXS data [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040592
AA Change: G102D

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043588
Gene: ENSMUSG00000033501
AA Change: G102D

DomainStartEndE-ValueType
XTALbg 7 86 5.98e-40 SMART
XTALbg 95 176 6.26e-43 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene can cause cataracts and/or disrupted lens fiber cell morphology and organization. Aging mice homozygous for a knock-out allele do not develop cataracts but show focusing defects associated with inefficient clearance of cellular organelles and altered actin distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,303,325 S843R probably benign Het
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Adora2a T A 10: 75,326,183 V52E probably damaging Het
Amph T A 13: 19,139,350 L594Q probably benign Het
Batf3 A T 1: 191,108,449 probably null Het
Ccdc146 C T 5: 21,308,612 probably null Het
Csn3 A G 5: 87,930,003 T123A possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gm19684 T A 17: 36,128,453 probably benign Het
Gstk1 T A 6: 42,246,914 D86E possibly damaging Het
Hus1 A G 11: 9,007,492 probably null Het
Kbtbd8 T C 6: 95,126,780 I547T probably benign Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Vmn1r184 A T 7: 26,266,962 L44F probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in Crygs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Crygs APN 16 22806562 missense possibly damaging 0.81
R1694:Crygs UTSW 16 22806675 splice site probably null
R1932:Crygs UTSW 16 22806554 missense probably benign 0.12
R2206:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2207:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2275:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2298:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2299:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2300:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2326:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2330:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2331:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2332:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2857:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2895:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2896:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2921:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2922:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3120:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3196:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3427:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3609:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3611:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3625:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3693:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3694:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3695:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3870:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3871:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3876:Crygs UTSW 16 22806512 missense probably damaging 1.00
R4052:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R4207:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R4299:Crygs UTSW 16 22805411 nonsense probably null
R4630:Crygs UTSW 16 22805518 missense possibly damaging 0.90
R7392:Crygs UTSW 16 22806502 missense probably benign 0.35
R7573:Crygs UTSW 16 22805319 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGAACTCTATGGTCCCACTCC -3'
(R):5'- AGAGTTCTGATGACCCTCCC -3'

Sequencing Primer
(F):5'- TCACTCCACAATGCGGCG -3'
(R):5'- TGATGACCCTCCCTTAAGGATGAG -3'
Posted On2014-10-30