Incidental Mutation 'R2329:Uhrf1'
ID245819
Institutional Source Beutler Lab
Gene Symbol Uhrf1
Ensembl Gene ENSMUSG00000001228
Gene Nameubiquitin-like, containing PHD and RING finger domains, 1
SynonymsICBP90, Np95
MMRRC Submission 040320-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2329 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56303321-56323486 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 56310671 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001258] [ENSMUST00000113035] [ENSMUST00000113038] [ENSMUST00000113039] [ENSMUST00000142387]
Predicted Effect probably null
Transcript: ENSMUST00000001258
SMART Domains Protein: ENSMUSP00000001258
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113035
SMART Domains Protein: ENSMUSP00000108658
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113038
SMART Domains Protein: ENSMUSP00000108661
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113039
SMART Domains Protein: ENSMUSP00000108662
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:TTD 128 281 8e-61 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137876
Predicted Effect probably null
Transcript: ENSMUST00000142387
SMART Domains Protein: ENSMUSP00000125830
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. The protein binds to specific DNA sequences, and recruits a histone deacetylase to regulate gene expression. Its expression peaks at late G1 phase and continues during G2 and M phases of the cell cycle. It plays a major role in the G1/S transition by regulating topoisomerase IIalpha and retinoblastoma gene expression, and functions in the p53-dependent DNA damage checkpoint. It is regarded as a hub protein for the integration of epigenetic information. This gene is up-regulated in various cancers, and it is therefore considered to be a therapeutic target. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene exists on chromosome 12. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruption of this marker die early in gestation showing growth retardation and various malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A C 13: 77,303,325 S843R probably benign Het
Adamts15 G T 9: 30,902,485 R795S probably damaging Het
Adora2a T A 10: 75,326,183 V52E probably damaging Het
Amph T A 13: 19,139,350 L594Q probably benign Het
Batf3 A T 1: 191,108,449 probably null Het
Ccdc146 C T 5: 21,308,612 probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csn3 A G 5: 87,930,003 T123A possibly damaging Het
Cspg4 A G 9: 56,888,550 T1190A probably benign Het
Dab2 C A 15: 6,429,563 Q298K possibly damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Efcab6 C T 15: 83,950,048 R453Q possibly damaging Het
Ern2 C T 7: 122,173,487 M610I possibly damaging Het
Fnip1 A G 11: 54,466,107 D38G probably damaging Het
Fosb T C 7: 19,307,185 T128A probably benign Het
Gad2 G A 2: 22,668,289 V340M probably damaging Het
Gm19684 T A 17: 36,128,453 probably benign Het
Gstk1 T A 6: 42,246,914 D86E possibly damaging Het
Hus1 A G 11: 9,007,492 probably null Het
Kbtbd8 T C 6: 95,126,780 I547T probably benign Het
Mrpl38 T A 11: 116,132,019 H373L possibly damaging Het
Nostrin A T 2: 69,161,094 T144S probably damaging Het
Prl8a6 T C 13: 27,437,067 H60R probably benign Het
Ros1 A G 10: 52,162,887 I329T probably damaging Het
Scd2 T A 19: 44,298,053 Y107* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc34a3 T C 2: 25,229,410 T483A possibly damaging Het
Slc35c1 A T 2: 92,458,695 Y155* probably null Het
Susd1 T C 4: 59,379,715 D304G possibly damaging Het
Taf5 C T 19: 47,075,124 S371L probably benign Het
Tenm4 A G 7: 96,895,862 T2362A probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Ttn G A 2: 76,769,442 P19102S probably damaging Het
Ttn A G 2: 76,778,068 V17837A probably damaging Het
Ulk4 C T 9: 121,272,887 E42K probably damaging Het
Vmn1r184 A T 7: 26,266,962 L44F probably damaging Het
Zfp932 A T 5: 110,009,540 H368L probably benign Het
Other mutations in Uhrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Uhrf1 APN 17 56318125 missense probably damaging 1.00
IGL00925:Uhrf1 APN 17 56320535 missense probably benign 0.00
IGL01432:Uhrf1 APN 17 56318250 missense probably damaging 1.00
IGL02739:Uhrf1 APN 17 56305129 missense probably benign 0.03
R0667:Uhrf1 UTSW 17 56310677 missense probably benign 0.01
R0685:Uhrf1 UTSW 17 56310742 missense probably damaging 0.99
R1121:Uhrf1 UTSW 17 56312917 missense probably benign
R1462:Uhrf1 UTSW 17 56318035 missense probably damaging 1.00
R1462:Uhrf1 UTSW 17 56318035 missense probably damaging 1.00
R2088:Uhrf1 UTSW 17 56318089 missense probably damaging 1.00
R2331:Uhrf1 UTSW 17 56310671 splice site probably null
R2332:Uhrf1 UTSW 17 56310671 splice site probably null
R3624:Uhrf1 UTSW 17 56317023 missense probably damaging 1.00
R4065:Uhrf1 UTSW 17 56318020 missense probably damaging 1.00
R4882:Uhrf1 UTSW 17 56309401 missense probably damaging 1.00
R4901:Uhrf1 UTSW 17 56310834 missense probably benign 0.01
R4913:Uhrf1 UTSW 17 56315478 missense probably damaging 0.99
R5061:Uhrf1 UTSW 17 56320542 splice site probably null
R5186:Uhrf1 UTSW 17 56318340 missense probably damaging 1.00
R5711:Uhrf1 UTSW 17 56320259 missense possibly damaging 0.49
R6917:Uhrf1 UTSW 17 56309574 missense probably damaging 1.00
R7021:Uhrf1 UTSW 17 56320450 missense probably benign 0.04
R7241:Uhrf1 UTSW 17 56315193 missense probably damaging 1.00
R7692:Uhrf1 UTSW 17 56312905 missense possibly damaging 0.91
R7875:Uhrf1 UTSW 17 56312884 missense possibly damaging 0.46
R7958:Uhrf1 UTSW 17 56312884 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGTACAGAATAGTCCAGTCTCATCC -3'
(R):5'- AGGACTGATGGCACTCACTC -3'

Sequencing Primer
(F):5'- CATCCAGTGTCCATAGTGCTGAG -3'
(R):5'- GATGGCACTCACTCATCATACTTGAC -3'
Posted On2014-10-30