Incidental Mutation 'R2330:Olfr1259'
ID245824
Institutional Source Beutler Lab
Gene Symbol Olfr1259
Ensembl Gene ENSMUSG00000068806
Gene Nameolfactory receptor 1259
SynonymsGA_x6K02T2Q125-51376062-51375133, MOR232-9
MMRRC Submission 040321-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R2330 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89940532-89948664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89943953 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 54 (N54S)
Ref Sequence ENSEMBL: ENSMUSP00000149652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090695] [ENSMUST00000214846]
Predicted Effect probably benign
Transcript: ENSMUST00000090695
AA Change: N54S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088194
Gene: ENSMUSG00000068806
AA Change: N54S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 8.9e-45 PFAM
Pfam:7tm_1 39 285 5.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214846
AA Change: N54S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp9a A G 2: 168,639,929 S958P probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Clasp2 T C 9: 113,876,304 V594A probably damaging Het
Col12a1 A G 9: 79,633,657 I2396T probably damaging Het
Col1a2 T A 6: 4,528,300 probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dnaja3 T A 16: 4,690,016 D127E probably benign Het
Etnppl T C 3: 130,630,575 L332P probably damaging Het
Gm4559 A T 7: 142,274,096 C90S unknown Het
Gramd1c T C 16: 43,983,203 N616D probably benign Het
Hmcn1 A G 1: 150,652,678 probably benign Het
Hydin C A 8: 110,565,009 Q3378K probably benign Het
Lin7b A G 7: 45,369,913 probably null Het
Mex3c G A 18: 73,573,728 V229I probably damaging Het
Micall2 C G 5: 139,717,515 G189R probably damaging Het
Ncam2 A G 16: 81,512,921 H433R probably benign Het
Olfr315 A T 11: 58,778,999 S291C probably damaging Het
Olfr774 C T 10: 129,239,039 Q297* probably null Het
Pml A T 9: 58,234,571 V326E probably damaging Het
Prl2c5 T A 13: 13,191,793 M219K possibly damaging Het
Rfc1 A T 5: 65,312,969 I65N possibly damaging Het
Rsbn1 T C 3: 103,914,500 L17P probably damaging Het
Serpina3m A G 12: 104,391,704 K296E possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Spag6l T C 16: 16,829,085 Q19R probably benign Het
Tgm6 A C 2: 130,143,242 D344A probably damaging Het
Zfp7 T C 15: 76,891,309 I517T probably damaging Het
Zfp831 T A 2: 174,648,089 Y1216* probably null Het
Other mutations in Olfr1259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1259 APN 2 89943260 missense probably damaging 0.96
IGL01446:Olfr1259 APN 2 89943938 missense probably damaging 0.99
IGL01830:Olfr1259 APN 2 89943431 missense probably benign 0.03
IGL02160:Olfr1259 APN 2 89943805 missense probably damaging 1.00
PIT4280001:Olfr1259 UTSW 2 89943743 missense probably damaging 1.00
R0366:Olfr1259 UTSW 2 89943818 missense possibly damaging 0.89
R0550:Olfr1259 UTSW 2 89943389 missense probably damaging 0.99
R0587:Olfr1259 UTSW 2 89943392 missense probably damaging 1.00
R1383:Olfr1259 UTSW 2 89943551 missense probably benign 0.12
R1400:Olfr1259 UTSW 2 89943542 missense possibly damaging 0.82
R1851:Olfr1259 UTSW 2 89943814 nonsense probably null
R1953:Olfr1259 UTSW 2 89943923 missense probably damaging 1.00
R3897:Olfr1259 UTSW 2 89943809 missense probably benign 0.24
R3955:Olfr1259 UTSW 2 89943828 missense possibly damaging 0.90
R4687:Olfr1259 UTSW 2 89943869 missense probably damaging 0.98
R4976:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5119:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5291:Olfr1259 UTSW 2 89943436 nonsense probably null
R5415:Olfr1259 UTSW 2 89943387 missense probably benign 0.25
R5546:Olfr1259 UTSW 2 89943585 missense probably damaging 1.00
R5588:Olfr1259 UTSW 2 89943792 missense probably benign 0.00
R6633:Olfr1259 UTSW 2 89943366 missense probably benign
R6858:Olfr1259 UTSW 2 89943743 missense probably damaging 0.99
R7294:Olfr1259 UTSW 2 89943724 nonsense probably null
R8261:Olfr1259 UTSW 2 89943372 missense probably benign 0.00
R8319:Olfr1259 UTSW 2 89943680 missense possibly damaging 0.87
Z1088:Olfr1259 UTSW 2 89943770 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAGCGGTCATAGGCCATCAC -3'
(R):5'- TCTGTGACTTGGTAGAACTCATAAG -3'

Sequencing Primer
(F):5'- GTCATAGGCCATCACTGTCAATAGG -3'
(R):5'- TGAAGATAAAATATTTTTGGGGAGGG -3'
Posted On2014-10-30