Incidental Mutation 'R2330:Micall2'
ID245833
Institutional Source Beutler Lab
Gene Symbol Micall2
Ensembl Gene ENSMUSG00000036718
Gene NameMICAL-like 2
SynonymsA930021H16Rik, Jrab, MICAL-L2
MMRRC Submission 040321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R2330 (G1)
Quality Score132
Status Validated
Chromosome5
Chromosomal Location139706696-139736336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 139717515 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 189 (G189R)
Ref Sequence ENSEMBL: ENSMUSP00000039707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044642] [ENSMUST00000170773]
Predicted Effect probably damaging
Transcript: ENSMUST00000044642
AA Change: G189R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039707
Gene: ENSMUSG00000036718
AA Change: G189R

DomainStartEndE-ValueType
CH 3 102 4.34e-20 SMART
LIM 187 241 1.62e-5 SMART
low complexity region 242 253 N/A INTRINSIC
low complexity region 326 344 N/A INTRINSIC
low complexity region 428 489 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 755 770 N/A INTRINSIC
DUF3585 840 980 3.1e-63 SMART
Predicted Effect unknown
Transcript: ENSMUST00000170773
AA Change: G106R
SMART Domains Protein: ENSMUSP00000127937
Gene: ENSMUSG00000036718
AA Change: G106R

DomainStartEndE-ValueType
SCOP:d1bkra_ 1 25 9e-5 SMART
Blast:DUF3585 1 45 2e-7 BLAST
LIM 104 158 1.62e-5 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 243 261 N/A INTRINSIC
low complexity region 345 406 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
DUF3585 757 897 3.1e-63 SMART
Meta Mutation Damage Score 0.1784 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp9a A G 2: 168,639,929 S958P probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Clasp2 T C 9: 113,876,304 V594A probably damaging Het
Col12a1 A G 9: 79,633,657 I2396T probably damaging Het
Col1a2 T A 6: 4,528,300 probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dnaja3 T A 16: 4,690,016 D127E probably benign Het
Etnppl T C 3: 130,630,575 L332P probably damaging Het
Gm4559 A T 7: 142,274,096 C90S unknown Het
Gramd1c T C 16: 43,983,203 N616D probably benign Het
Hmcn1 A G 1: 150,652,678 probably benign Het
Hydin C A 8: 110,565,009 Q3378K probably benign Het
Lin7b A G 7: 45,369,913 probably null Het
Mex3c G A 18: 73,573,728 V229I probably damaging Het
Ncam2 A G 16: 81,512,921 H433R probably benign Het
Olfr1259 T C 2: 89,943,953 N54S probably benign Het
Olfr315 A T 11: 58,778,999 S291C probably damaging Het
Olfr774 C T 10: 129,239,039 Q297* probably null Het
Pml A T 9: 58,234,571 V326E probably damaging Het
Prl2c5 T A 13: 13,191,793 M219K possibly damaging Het
Rfc1 A T 5: 65,312,969 I65N possibly damaging Het
Rsbn1 T C 3: 103,914,500 L17P probably damaging Het
Serpina3m A G 12: 104,391,704 K296E possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Spag6l T C 16: 16,829,085 Q19R probably benign Het
Tgm6 A C 2: 130,143,242 D344A probably damaging Het
Zfp7 T C 15: 76,891,309 I517T probably damaging Het
Zfp831 T A 2: 174,648,089 Y1216* probably null Het
Other mutations in Micall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Micall2 APN 5 139717556 critical splice acceptor site probably null
IGL00496:Micall2 APN 5 139716328 missense probably benign 0.01
IGL02641:Micall2 APN 5 139719339 missense probably damaging 1.00
IGL03245:Micall2 APN 5 139719259 missense probably damaging 1.00
IGL03252:Micall2 APN 5 139716726 missense probably benign 0.01
R1214:Micall2 UTSW 5 139711641 missense probably damaging 0.97
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1831:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1833:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1969:Micall2 UTSW 5 139736130 missense probably damaging 1.00
R2023:Micall2 UTSW 5 139717511 missense possibly damaging 0.51
R2060:Micall2 UTSW 5 139711562 missense probably damaging 0.98
R3820:Micall2 UTSW 5 139715856 missense possibly damaging 0.92
R4299:Micall2 UTSW 5 139709471 intron probably benign
R4334:Micall2 UTSW 5 139713350 missense probably damaging 1.00
R4451:Micall2 UTSW 5 139707097 missense probably damaging 1.00
R4769:Micall2 UTSW 5 139706886 missense probably damaging 0.97
R4911:Micall2 UTSW 5 139716825 missense probably damaging 1.00
R4996:Micall2 UTSW 5 139710589 missense probably benign 0.31
R5118:Micall2 UTSW 5 139716447 missense probably damaging 1.00
R5155:Micall2 UTSW 5 139710231 missense probably damaging 1.00
R5475:Micall2 UTSW 5 139716469 missense probably damaging 1.00
R5750:Micall2 UTSW 5 139715701 splice site probably null
R5998:Micall2 UTSW 5 139706911 critical splice acceptor site probably null
R6181:Micall2 UTSW 5 139716751 missense probably benign 0.41
R6852:Micall2 UTSW 5 139715793 missense possibly damaging 0.90
R7046:Micall2 UTSW 5 139708944 unclassified probably benign
R7395:Micall2 UTSW 5 139716369 missense possibly damaging 0.78
Z1088:Micall2 UTSW 5 139706894 missense probably damaging 1.00
Z1088:Micall2 UTSW 5 139716295 missense probably benign 0.12
Z1177:Micall2 UTSW 5 139710302 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGAGGATATTGGGGTTCAGCTATAC -3'
(R):5'- TCTTTCCAACGAGGCCACTG -3'

Sequencing Primer
(F):5'- GGGTTCAGCTATACTGTCACCAATG -3'
(R):5'- AAGGTCCTGAGTGTGTAGCCAC -3'
Posted On2014-10-30