Incidental Mutation 'R0284:Kiz'
ID24585
Institutional Source Beutler Lab
Gene Symbol Kiz
Ensembl Gene ENSMUSG00000074749
Gene Namekizuna centrosomal protein
SynonymsPlk1s1, LOC228730, Ncrna00153, Gm114
MMRRC Submission 038505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0284 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location146855864-146970097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146863810 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 97 (C97S)
Ref Sequence ENSEMBL: ENSMUSP00000121952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099278] [ENSMUST00000156232]
Predicted Effect probably benign
Transcript: ENSMUST00000099278
AA Change: C97S

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749
AA Change: C97S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
coiled coil region 102 132 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 376 399 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156232
AA Change: C97S

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121952
Gene: ENSMUSG00000074749
AA Change: C97S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.4%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T G 4: 41,507,538 E150A probably damaging Het
Akap2 T C 4: 57,855,207 F220L probably damaging Het
Alkbh6 A G 7: 30,313,988 T161A probably benign Het
Alox12e A G 11: 70,320,899 probably benign Het
Ap1g2 A G 14: 55,101,692 probably benign Het
Arid2 A T 15: 96,378,967 probably benign Het
Bmp2k A T 5: 97,068,455 H604L unknown Het
Cacna1a A T 8: 84,612,285 M1705L probably damaging Het
Cacna1d A T 14: 30,072,105 D1526E probably damaging Het
Ccdc171 A G 4: 83,549,738 R107G possibly damaging Het
Cklf T C 8: 104,261,575 probably benign Het
Crabp1 A G 9: 54,764,926 K9E probably benign Het
Cspg4 A G 9: 56,886,139 D386G probably damaging Het
Cyp3a41b G A 5: 145,578,204 probably benign Het
Dsg1a T A 18: 20,331,627 V393E probably damaging Het
Ednrb C T 14: 103,820,013 G371D probably damaging Het
Efcab5 T C 11: 77,103,527 probably benign Het
Exoc2 A T 13: 30,877,625 probably benign Het
Fbn2 G A 18: 58,050,290 probably benign Het
Foxo6 T C 4: 120,269,002 S199G probably benign Het
Fpr1 T A 17: 17,877,356 I124F probably damaging Het
Gk5 A T 9: 96,181,770 probably null Het
Gys1 A T 7: 45,436,719 probably benign Het
Igfbp1 T C 11: 7,198,103 S49P probably damaging Het
Incenp A T 19: 9,893,993 S91T unknown Het
Itpkc G A 7: 27,214,543 R498* probably null Het
Kat6a A G 8: 22,939,803 T1725A unknown Het
Kri1 A G 9: 21,276,552 probably benign Het
Lipn A G 19: 34,080,706 S276G possibly damaging Het
Llgl1 A G 11: 60,712,141 T881A probably damaging Het
Man1a2 T C 3: 100,684,786 H26R probably damaging Het
Map3k5 T A 10: 20,000,613 F173I probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 A G 12: 57,457,069 Q341R probably damaging Het
Mllt6 G T 11: 97,678,605 A928S probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nipsnap3a C T 4: 52,997,178 T150I probably benign Het
Nsl1 A G 1: 191,065,230 E97G probably damaging Het
Olfr1278 T C 2: 111,292,586 V106A probably benign Het
Olfr251 G A 9: 38,378,584 M234I probably benign Het
Olfr736 G A 14: 50,392,995 V80M probably damaging Het
Olfr830 A T 9: 18,875,552 Y72F probably benign Het
Pdcd6ip A G 9: 113,662,504 L552S probably damaging Het
Plekhf2 T C 4: 10,990,595 probably benign Het
Prdm1 T C 10: 44,456,626 E96G probably damaging Het
Prpf40a T A 2: 53,150,647 E608D probably damaging Het
Prpf40b A T 15: 99,316,393 probably benign Het
Rag2 T C 2: 101,630,119 V258A probably damaging Het
S100a5 A G 3: 90,611,574 I68V probably benign Het
Serpinb8 G A 1: 107,602,918 probably null Het
Slc24a4 T C 12: 102,260,481 V492A probably damaging Het
Spag6l T A 16: 16,780,766 Q287L probably damaging Het
Synpo2 C T 3: 123,079,734 W211* probably null Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trerf1 A G 17: 47,319,545 noncoding transcript Het
Ttn G C 2: 76,846,704 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps13d A T 4: 145,144,802 M1900K probably benign Het
Vps41 A T 13: 18,853,440 D691V probably damaging Het
Zfp518b T C 5: 38,671,740 Y974C probably damaging Het
Zscan29 A T 2: 121,166,733 probably benign Het
Other mutations in Kiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Kiz APN 2 146863801 missense probably benign 0.22
IGL01649:Kiz APN 2 146889309 missense probably benign 0.35
IGL02184:Kiz APN 2 146889600 missense probably benign 0.20
IGL02500:Kiz APN 2 146863813 missense probably benign 0.06
IGL02548:Kiz APN 2 146870770 missense probably damaging 0.99
R0364:Kiz UTSW 2 146942156 missense probably benign 0.20
R0478:Kiz UTSW 2 146942158 missense possibly damaging 0.93
R0685:Kiz UTSW 2 146856058 splice site probably benign
R0767:Kiz UTSW 2 146889051 missense probably damaging 1.00
R0866:Kiz UTSW 2 146856053 splice site probably benign
R1180:Kiz UTSW 2 146970007 missense unknown
R2037:Kiz UTSW 2 146969960 missense probably damaging 1.00
R2055:Kiz UTSW 2 146891283 missense probably benign 0.10
R2877:Kiz UTSW 2 146889556 missense possibly damaging 0.75
R4780:Kiz UTSW 2 146889246 missense possibly damaging 0.90
R4822:Kiz UTSW 2 146891069 missense probably damaging 1.00
R4835:Kiz UTSW 2 146942088 missense probably damaging 1.00
R5004:Kiz UTSW 2 146969979 missense possibly damaging 0.83
R5473:Kiz UTSW 2 146969995 nonsense probably null
R5878:Kiz UTSW 2 146889601 missense probably damaging 0.99
R6216:Kiz UTSW 2 146889497 missense probably damaging 1.00
R6222:Kiz UTSW 2 146891061 missense probably damaging 1.00
R7144:Kiz UTSW 2 146950510 splice site probably null
R7475:Kiz UTSW 2 146891086 missense possibly damaging 0.90
R7580:Kiz UTSW 2 146956249 missense probably damaging 0.99
R7848:Kiz UTSW 2 146889180 missense probably benign 0.19
R8395:Kiz UTSW 2 146953029 missense possibly damaging 0.79
R8513:Kiz UTSW 2 146870764 critical splice acceptor site probably null
RF021:Kiz UTSW 2 146870830 missense possibly damaging 0.74
Z1177:Kiz UTSW 2 146935827 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- AACCCATGTGTCTGGGAATGCTG -3'
(R):5'- AATGGACTCCTGCCCTGAAGAGAG -3'

Sequencing Primer
(F):5'- CCTGAAGGAAGTATGTGAGTCTGA -3'
(R):5'- CCTGAAGAGAGCAGCCCAG -3'
Posted On2013-04-16