Incidental Mutation 'R2330:Crygs'
ID 245853
Institutional Source Beutler Lab
Gene Symbol Crygs
Ensembl Gene ENSMUSG00000033501
Gene Name crystallin, gamma S
Synonyms Opj
MMRRC Submission 040321-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2330 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 22623953-22630160 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 22624301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 102 (G102D)
Ref Sequence ENSEMBL: ENSMUSP00000043588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040592]
AlphaFold O35486
PDB Structure NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin from joint refinement with SAXS data [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040592
AA Change: G102D

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043588
Gene: ENSMUSG00000033501
AA Change: G102D

DomainStartEndE-ValueType
XTALbg 7 86 5.98e-40 SMART
XTALbg 95 176 6.26e-43 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene can cause cataracts and/or disrupted lens fiber cell morphology and organization. Aging mice homozygous for a knock-out allele do not develop cataracts but show focusing defects associated with inefficient clearance of cellular organelles and altered actin distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp9a A G 2: 168,481,849 (GRCm39) S958P probably benign Het
Cdh15 G A 8: 123,583,374 (GRCm39) R59H probably benign Het
Clasp2 T C 9: 113,705,372 (GRCm39) V594A probably damaging Het
Col12a1 A G 9: 79,540,939 (GRCm39) I2396T probably damaging Het
Col1a2 T A 6: 4,528,300 (GRCm39) probably benign Het
Dnaja3 T A 16: 4,507,880 (GRCm39) D127E probably benign Het
Etnppl T C 3: 130,424,224 (GRCm39) L332P probably damaging Het
Gm4559 A T 7: 141,827,833 (GRCm39) C90S unknown Het
Gramd1c T C 16: 43,803,566 (GRCm39) N616D probably benign Het
Hmcn1 A G 1: 150,528,429 (GRCm39) probably benign Het
Hydin C A 8: 111,291,641 (GRCm39) Q3378K probably benign Het
Lin7b A G 7: 45,019,337 (GRCm39) probably null Het
Mex3c G A 18: 73,706,799 (GRCm39) V229I probably damaging Het
Micall2 C G 5: 139,703,270 (GRCm39) G189R probably damaging Het
Ncam2 A G 16: 81,309,809 (GRCm39) H433R probably benign Het
Or2t45 A T 11: 58,669,825 (GRCm39) S291C probably damaging Het
Or4c12 T C 2: 89,774,297 (GRCm39) N54S probably benign Het
Or6c5 C T 10: 129,074,908 (GRCm39) Q297* probably null Het
Pml A T 9: 58,141,854 (GRCm39) V326E probably damaging Het
Prl2c5 T A 13: 13,366,378 (GRCm39) M219K possibly damaging Het
Rfc1 A T 5: 65,470,312 (GRCm39) I65N possibly damaging Het
Rsbn1 T C 3: 103,821,816 (GRCm39) L17P probably damaging Het
Serpina3m A G 12: 104,357,963 (GRCm39) K296E possibly damaging Het
Sh3rf1 C T 8: 61,679,321 (GRCm39) P121L probably benign Het
Spag6l T C 16: 16,646,949 (GRCm39) Q19R probably benign Het
Tgm6 A C 2: 129,985,162 (GRCm39) D344A probably damaging Het
Zfp7 T C 15: 76,775,509 (GRCm39) I517T probably damaging Het
Zfp831 T A 2: 174,489,882 (GRCm39) Y1216* probably null Het
Other mutations in Crygs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Crygs APN 16 22,625,312 (GRCm39) missense possibly damaging 0.81
R1694:Crygs UTSW 16 22,625,425 (GRCm39) splice site probably null
R1932:Crygs UTSW 16 22,625,304 (GRCm39) missense probably benign 0.12
R2206:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2207:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2275:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2298:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2299:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2300:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2326:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2329:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2331:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2332:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2857:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2895:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2896:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2921:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2922:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3120:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3196:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3427:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3609:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3611:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3625:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3693:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3694:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3695:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3870:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3871:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3876:Crygs UTSW 16 22,625,262 (GRCm39) missense probably damaging 1.00
R4052:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R4207:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R4299:Crygs UTSW 16 22,624,161 (GRCm39) nonsense probably null
R4630:Crygs UTSW 16 22,624,268 (GRCm39) missense possibly damaging 0.90
R7392:Crygs UTSW 16 22,625,252 (GRCm39) missense probably benign 0.35
R7573:Crygs UTSW 16 22,624,069 (GRCm39) makesense probably null
R7954:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R7955:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R7957:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R8172:Crygs UTSW 16 22,625,292 (GRCm39) missense probably damaging 1.00
R9653:Crygs UTSW 16 22,625,304 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AACTCTATGGTCCCACTCCAGG -3'
(R):5'- AGAGTTCTGATGACCCTCCC -3'

Sequencing Primer
(F):5'- TCACTCCACAATGCGGCG -3'
(R):5'- TGATGACCCTCCCTTAAGGATGAG -3'
Posted On 2014-10-30