Incidental Mutation 'R0279:Celsr1'
ID24586
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Namecadherin, EGF LAG seven-pass G-type receptor 1
Synonymscrash, Crsh, Scy
MMRRC Submission 038501-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock #R0279 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85898929-86033777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85902864 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 2761 (E2761D)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
Predicted Effect probably benign
Transcript: ENSMUST00000016172
AA Change: E2761D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: E2761D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000226204
AA Change: E65D
Predicted Effect unknown
Transcript: ENSMUST00000226840
AA Change: E1394D
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610528J11Rik A T 4: 118,529,293 M1L probably benign Het
5730596B20Rik T A 6: 52,179,202 probably benign Het
Acrbp T C 6: 125,053,954 probably null Het
Acss3 A G 10: 107,084,871 I126T possibly damaging Het
Aff3 T C 1: 38,535,569 E110G probably damaging Het
Aldh1a3 T C 7: 66,409,252 I113V probably benign Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Atp2b4 A G 1: 133,729,702 probably benign Het
Atp8a1 C T 5: 67,813,092 probably null Het
Bhmt A G 13: 93,625,464 C104R probably damaging Het
Ccdc151 A G 9: 21,990,247 probably benign Het
Cct5 T G 15: 31,591,031 E508A probably damaging Het
Clstn1 T C 4: 149,643,674 S600P probably damaging Het
Cnppd1 A G 1: 75,136,929 S232P probably damaging Het
Crybb3 T C 5: 113,079,753 probably null Het
Csmd1 A G 8: 16,223,235 I861T probably damaging Het
Cyp2d10 A C 15: 82,405,339 S191A possibly damaging Het
Ddx10 T C 9: 53,235,304 D206G probably damaging Het
Dnah1 G T 14: 31,302,375 H916N possibly damaging Het
Dnah9 A G 11: 65,911,789 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Etnppl A G 3: 130,629,413 R248G probably damaging Het
Eya3 T C 4: 132,719,247 F369L probably damaging Het
Fam129a T C 1: 151,709,206 probably null Het
Fam170b T C 14: 32,834,068 probably benign Het
Fli1 A T 9: 32,461,427 V105D probably damaging Het
Fmo1 T C 1: 162,830,272 I433M possibly damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Foxe3 T C 4: 114,925,568 D149G probably damaging Het
Gk5 T C 9: 96,174,804 probably benign Het
Gm14226 A G 2: 155,025,452 D443G possibly damaging Het
Gm9796 C T 11: 95,697,995 noncoding transcript Het
Golga4 A T 9: 118,568,993 R52S probably benign Het
Hey2 C A 10: 30,834,010 C249F probably damaging Het
Ipo9 A T 1: 135,420,363 probably benign Het
Ireb2 C A 9: 54,886,593 T269K probably benign Het
Kansl3 A G 1: 36,351,969 V274A probably damaging Het
Kcnk2 C T 1: 189,209,972 A352T possibly damaging Het
Lamc2 T C 1: 153,130,696 E903G probably benign Het
Lepr A G 4: 101,750,344 K253R probably benign Het
Lmntd2 T C 7: 141,213,623 probably benign Het
Lrrc39 A T 3: 116,578,303 T240S probably benign Het
Lrrc43 A G 5: 123,497,022 probably null Het
Maf T C 8: 115,705,756 M370V possibly damaging Het
Mib2 G A 4: 155,661,216 S46L possibly damaging Het
Mms22l C T 4: 24,497,867 T63I probably damaging Het
Morc2a T A 11: 3,683,989 S700R probably benign Het
Mpz A G 1: 171,159,929 probably benign Het
Ncam2 T C 16: 81,623,337 probably benign Het
Nudt14 C T 12: 112,938,417 A123T probably damaging Het
Olfr1016 A T 2: 85,799,535 I245N possibly damaging Het
Olfr13 G A 6: 43,174,758 M257I probably benign Het
Olfr239 C T 17: 33,199,324 T92I probably benign Het
Otoa T C 7: 121,111,079 probably benign Het
Pik3cg G A 12: 32,204,791 T399I probably damaging Het
Pkn3 C T 2: 30,083,297 A377V probably benign Het
Ppan A G 9: 20,891,529 N327S probably benign Het
Prkca T C 11: 108,054,111 probably benign Het
Prrc2c A T 1: 162,715,464 V320E probably damaging Het
Ptprq A G 10: 107,608,417 V1442A probably damaging Het
Rapgef1 C T 2: 29,726,227 R834C probably damaging Het
Rbms1 G T 2: 60,842,410 N44K probably damaging Het
Rfwd3 A C 8: 111,282,733 F404V probably benign Het
Rimbp3 G T 16: 17,209,453 R247L probably benign Het
Serpinb1b T C 13: 33,093,713 S310P possibly damaging Het
Smtn C A 11: 3,530,235 V329L probably damaging Het
Snapc2 T C 8: 4,254,979 probably benign Het
Spam1 A T 6: 24,800,419 M386L probably benign Het
Syne2 A G 12: 76,095,613 E6208G probably damaging Het
Teddm1a T C 1: 153,892,623 Y278H probably damaging Het
Tnfaip6 A T 2: 52,055,916 N258I possibly damaging Het
Trpm4 C T 7: 45,322,048 R188Q probably damaging Het
Ttbk2 A T 2: 120,748,960 H491Q probably benign Het
Urgcp C T 11: 5,716,989 E450K probably benign Het
Vmn1r228 T C 17: 20,776,375 N294D probably benign Het
Wdfy3 A T 5: 101,868,092 C2606S probably damaging Het
Wdr33 T A 18: 31,888,324 H642Q unknown Het
Zbtb46 A G 2: 181,411,774 S382P possibly damaging Het
Zfp217 A G 2: 170,119,780 I209T probably benign Het
Zranb3 T A 1: 127,963,773 N822I probably benign Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85931345 missense probably benign 0.04
IGL00519:Celsr1 APN 15 86030836 missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85922235 missense probably damaging 1.00
IGL01303:Celsr1 APN 15 86030491 missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85926190 missense probably benign 0.35
IGL01910:Celsr1 APN 15 85929895 missense probably benign
IGL01931:Celsr1 APN 15 85907660 missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85963223 missense probably benign 0.35
IGL02090:Celsr1 APN 15 85907721 missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85979004 missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85929907 missense probably benign 0.01
IGL02413:Celsr1 APN 15 86031226 missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85941136 missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85900688 utr 3 prime probably benign
IGL02508:Celsr1 APN 15 86030617 nonsense probably null
IGL02899:Celsr1 APN 15 86031726 missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85901472 missense probably benign
IGL03212:Celsr1 APN 15 85930677 missense probably benign 0.04
P0028:Celsr1 UTSW 15 85922235 missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85900937 missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 86032414 missense probably damaging 0.99
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85929419 missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 86030762 missense probably benign 0.02
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0570:Celsr1 UTSW 15 85903365 missense probably benign 0.18
R0611:Celsr1 UTSW 15 85932323 missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85901597 missense probably benign
R0792:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R0943:Celsr1 UTSW 15 85903288 missense probably damaging 1.00
R0989:Celsr1 UTSW 15 86031279 missense probably benign 0.39
R1118:Celsr1 UTSW 15 86032047 missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85903974 missense probably benign 0.01
R1239:Celsr1 UTSW 15 85979146 missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1522:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R1662:Celsr1 UTSW 15 86031062 missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85932457 missense probably benign 0.00
R1795:Celsr1 UTSW 15 86030323 missense probably damaging 0.99
R1799:Celsr1 UTSW 15 86032685 missense probably damaging 1.00
R1858:Celsr1 UTSW 15 86032759 missense probably damaging 1.00
R2040:Celsr1 UTSW 15 86032887 missense probably damaging 1.00
R2050:Celsr1 UTSW 15 86030547 missense probably benign 0.02
R2131:Celsr1 UTSW 15 85963223 missense probably benign 0.35
R2132:Celsr1 UTSW 15 86031967 missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85979230 missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85916723 missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 86031807 missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85978827 missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85963133 missense probably benign 0.00
R4414:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4416:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85916756 missense probably benign 0.35
R4666:Celsr1 UTSW 15 86030494 missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85932460 missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85906029 critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85937953 missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85937911 missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85939134 missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85932384 missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85930546 missense probably benign
R5310:Celsr1 UTSW 15 85926222 missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85931282 missense probably benign 0.00
R5639:Celsr1 UTSW 15 86030767 missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85941264 missense probably benign 0.27
R5778:Celsr1 UTSW 15 86032955 missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85904014 missense probably benign 0.02
R5915:Celsr1 UTSW 15 85937975 missense probably benign
R5915:Celsr1 UTSW 15 86030349 missense probably damaging 0.96
R5932:Celsr1 UTSW 15 86032704 missense probably damaging 1.00
R5950:Celsr1 UTSW 15 86032500 missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85919038 splice site probably null
R6050:Celsr1 UTSW 15 85930611 missense probably benign 0.00
R6117:Celsr1 UTSW 15 85932411 missense probably benign 0.04
R6178:Celsr1 UTSW 15 85901021 missense probably benign 0.08
R6186:Celsr1 UTSW 15 85921193 missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85916687 missense probably benign 0.25
R6307:Celsr1 UTSW 15 85928330 missense probably benign
R6320:Celsr1 UTSW 15 85900959 missense probably benign 0.13
R6349:Celsr1 UTSW 15 86031684 missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85978920 missense probably benign 0.07
R6607:Celsr1 UTSW 15 85963285 missense probably benign
R6615:Celsr1 UTSW 15 85902114 critical splice donor site probably null
R6661:Celsr1 UTSW 15 85918934 missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85905914 critical splice donor site probably null
R6743:Celsr1 UTSW 15 85907598 missense probably damaging 0.96
R6746:Celsr1 UTSW 15 86031495 missense probably damaging 1.00
R6772:Celsr1 UTSW 15 86030782 missense probably benign
R6838:Celsr1 UTSW 15 85939194 missense probably benign
R6886:Celsr1 UTSW 15 86031654 missense probably benign 0.00
R7030:Celsr1 UTSW 15 85905478 missense probably damaging 0.99
R7060:Celsr1 UTSW 15 86032655 missense probably benign 0.07
R7080:Celsr1 UTSW 15 85932451 missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 86033008 missense probably damaging 0.99
R7357:Celsr1 UTSW 15 86030514 missense probably benign 0.00
R7371:Celsr1 UTSW 15 86030674 missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85907673 missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 86033392 missense probably benign
R7491:Celsr1 UTSW 15 86032518 missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85929872 missense probably benign 0.00
R7685:Celsr1 UTSW 15 85978732 nonsense probably null
R7741:Celsr1 UTSW 15 85979102 missense possibly damaging 0.94
R7768:Celsr1 UTSW 15 85932409 missense probably benign
R7974:Celsr1 UTSW 15 86031030 missense probably damaging 1.00
R7977:Celsr1 UTSW 15 86032993 missense probably damaging 1.00
R7987:Celsr1 UTSW 15 86032993 missense probably damaging 1.00
R8073:Celsr1 UTSW 15 85939155 missense probably benign 0.00
R8099:Celsr1 UTSW 15 86031600 missense probably damaging 0.99
R8190:Celsr1 UTSW 15 85902889 missense probably damaging 0.99
R8210:Celsr1 UTSW 15 85979235 missense probably benign 0.00
R8289:Celsr1 UTSW 15 86033085 nonsense probably null
R8290:Celsr1 UTSW 15 86033085 nonsense probably null
R8292:Celsr1 UTSW 15 85907618 missense possibly damaging 0.90
R8328:Celsr1 UTSW 15 85922244 missense probably benign 0.00
R8330:Celsr1 UTSW 15 85932300 missense probably damaging 0.99
R8333:Celsr1 UTSW 15 86031414 missense possibly damaging 0.65
R8352:Celsr1 UTSW 15 86033085 nonsense probably null
R8384:Celsr1 UTSW 15 86033085 nonsense probably null
R8452:Celsr1 UTSW 15 86033085 nonsense probably null
R8463:Celsr1 UTSW 15 86030214 missense probably damaging 1.00
R8479:Celsr1 UTSW 15 86033085 nonsense probably null
R8480:Celsr1 UTSW 15 86033085 nonsense probably null
R8493:Celsr1 UTSW 15 85938006 missense possibly damaging 0.67
R8498:Celsr1 UTSW 15 85939105 missense probably benign 0.01
R8506:Celsr1 UTSW 15 86033085 nonsense probably null
Z1176:Celsr1 UTSW 15 85963100 missense probably damaging 0.96
Z1177:Celsr1 UTSW 15 85978851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCCGTGTCACAGAGCATCTAC -3'
(R):5'- GCAGCTACAACCAGAAGCAGTTTCC -3'

Sequencing Primer
(F):5'- GGGAAGTTCCTCTAAGCCCAC -3'
(R):5'- AGGTGTTTCCACTCAGTGC -3'
Posted On2013-04-16