Incidental Mutation 'R2331:Lcn11'
ID245860
Institutional Source Beutler Lab
Gene Symbol Lcn11
Ensembl Gene ENSMUSG00000069080
Gene Namelipocalin 11
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R2331 (G1)
Quality Score188
Status Not validated
Chromosome2
Chromosomal Location25777017-25780279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25780176 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 177 (T177K)
Ref Sequence ENSEMBL: ENSMUSP00000088822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091278] [ENSMUST00000211245]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091278
AA Change: T177K

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088822
Gene: ENSMUSG00000069080
AA Change: T177K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Lipocalin 34 172 7.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153913
Predicted Effect probably benign
Transcript: ENSMUST00000211245
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C T 1: 38,204,890 probably null Het
Cadps A G 14: 12,603,692 I376T probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gm10295 A C 7: 71,350,689 S48A unknown Het
Gstcd A G 3: 132,998,880 C538R probably damaging Het
Hcn3 A T 3: 89,148,090 S617T probably benign Het
Hectd4 A G 5: 121,320,026 I752V probably benign Het
Itgb7 G T 15: 102,223,548 T200K probably damaging Het
Lsm14a A G 7: 34,357,490 V241A probably benign Het
Magi1 T C 6: 93,685,562 K1075E probably damaging Het
Olfr1216 T C 2: 89,013,921 I48V probably benign Het
Olfr1426 C A 19: 12,088,158 L211F probably benign Het
P4hb T C 11: 120,568,280 N129S probably benign Het
Piezo1 C T 8: 122,487,266 probably null Het
Ppp3ca T C 3: 136,797,819 M51T probably benign Het
Sema6d T C 2: 124,658,063 V353A probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Sh3rf2 T C 18: 42,053,863 F16L probably benign Het
Sparcl1 A G 5: 104,085,794 L563P probably damaging Het
Stra6l T C 4: 45,858,224 probably null Het
Sult2a6 A T 7: 14,225,870 M246K possibly damaging Het
Trpv5 A G 6: 41,659,968 S399P probably damaging Het
Uggt2 A T 14: 119,026,599 F1006L possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Wdr72 A G 9: 74,148,326 Y279C probably damaging Het
Other mutations in Lcn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02904:Lcn11 APN 2 25779266 missense probably null 0.00
R0220:Lcn11 UTSW 2 25777831 missense probably benign 0.02
R0607:Lcn11 UTSW 2 25779293 missense probably benign 0.00
R1104:Lcn11 UTSW 2 25779103 unclassified probably benign
R2021:Lcn11 UTSW 2 25778085 missense probably benign 0.34
R4295:Lcn11 UTSW 2 25778099 missense possibly damaging 0.83
R6109:Lcn11 UTSW 2 25779296 missense possibly damaging 0.78
R6356:Lcn11 UTSW 2 25778120 nonsense probably null
R6502:Lcn11 UTSW 2 25779091 missense probably benign 0.08
R7754:Lcn11 UTSW 2 25777818 missense probably benign 0.06
Z1176:Lcn11 UTSW 2 25777724 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAAACTTGGTTTATCTCATTGC -3'
(R):5'- TCAGAAGCTAGGTGAGTGCC -3'

Sequencing Primer
(F):5'- CCTGGGTGTGGAAGGCCTAG -3'
(R):5'- GTGAGTGCCACCCCTCC -3'
Posted On2014-10-30