Incidental Mutation 'R2331:Sparcl1'
ID245868
Institutional Source Beutler Lab
Gene Symbol Sparcl1
Ensembl Gene ENSMUSG00000029309
Gene NameSPARC-like 1
SynonymsEcm2, mast9, Sc1, hevin
Accession Numbers

Ncbi RefSeq: NM_010097.4; MGI:108110

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2331 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104079111-104113733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104085794 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 563 (L563P)
Ref Sequence ENSEMBL: ENSMUSP00000031249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031249]
Predicted Effect probably damaging
Transcript: ENSMUST00000031249
AA Change: L563P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031249
Gene: ENSMUSG00000029309
AA Change: L563P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 90 101 N/A INTRINSIC
low complexity region 192 210 N/A INTRINSIC
low complexity region 330 340 N/A INTRINSIC
low complexity region 372 381 N/A INTRINSIC
FOLN 418 441 2.33e-5 SMART
KAZAL 441 495 3.62e-11 SMART
Pfam:SPARC_Ca_bdg 498 636 2.8e-44 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype Strain: 2153047
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal histology and survival. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(1) Gene trapped(4)

Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C T 1: 38,204,890 probably null Het
Cadps A G 14: 12,603,692 I376T probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gm10295 A C 7: 71,350,689 S48A unknown Het
Gstcd A G 3: 132,998,880 C538R probably damaging Het
Hcn3 A T 3: 89,148,090 S617T probably benign Het
Hectd4 A G 5: 121,320,026 I752V probably benign Het
Itgb7 G T 15: 102,223,548 T200K probably damaging Het
Lcn11 C A 2: 25,780,176 T177K possibly damaging Het
Lsm14a A G 7: 34,357,490 V241A probably benign Het
Magi1 T C 6: 93,685,562 K1075E probably damaging Het
Olfr1216 T C 2: 89,013,921 I48V probably benign Het
Olfr1426 C A 19: 12,088,158 L211F probably benign Het
P4hb T C 11: 120,568,280 N129S probably benign Het
Piezo1 C T 8: 122,487,266 probably null Het
Ppp3ca T C 3: 136,797,819 M51T probably benign Het
Sema6d T C 2: 124,658,063 V353A probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Sh3rf2 T C 18: 42,053,863 F16L probably benign Het
Stra6l T C 4: 45,858,224 probably null Het
Sult2a6 A T 7: 14,225,870 M246K possibly damaging Het
Trpv5 A G 6: 41,659,968 S399P probably damaging Het
Uggt2 A T 14: 119,026,599 F1006L possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Wdr72 A G 9: 74,148,326 Y279C probably damaging Het
Other mutations in Sparcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Sparcl1 APN 5 104092922 missense probably benign 0.04
IGL01291:Sparcl1 APN 5 104094715 missense possibly damaging 0.88
IGL01958:Sparcl1 APN 5 104092540 missense probably benign 0.30
IGL02749:Sparcl1 APN 5 104092880 missense possibly damaging 0.57
IGL03034:Sparcl1 APN 5 104093237 missense probably damaging 0.96
ANU05:Sparcl1 UTSW 5 104094715 missense possibly damaging 0.88
R0007:Sparcl1 UTSW 5 104087080 missense probably damaging 1.00
R0007:Sparcl1 UTSW 5 104087080 missense probably damaging 1.00
R0071:Sparcl1 UTSW 5 104085841 nonsense probably null
R0071:Sparcl1 UTSW 5 104085841 nonsense probably null
R0278:Sparcl1 UTSW 5 104088397 missense probably benign 0.16
R0360:Sparcl1 UTSW 5 104089637 missense probably damaging 0.99
R0581:Sparcl1 UTSW 5 104093312 missense probably damaging 0.99
R1755:Sparcl1 UTSW 5 104092824 missense probably benign 0.12
R1807:Sparcl1 UTSW 5 104085761 missense probably damaging 1.00
R1925:Sparcl1 UTSW 5 104093354 missense probably benign 0.09
R2110:Sparcl1 UTSW 5 104088423 missense probably damaging 1.00
R2112:Sparcl1 UTSW 5 104088423 missense probably damaging 1.00
R2567:Sparcl1 UTSW 5 104085088 missense probably damaging 1.00
R3029:Sparcl1 UTSW 5 104093226 missense possibly damaging 0.59
R3104:Sparcl1 UTSW 5 104093337 missense probably benign 0.00
R3106:Sparcl1 UTSW 5 104093337 missense probably benign 0.00
R3979:Sparcl1 UTSW 5 104092781 missense probably benign 0.00
R4772:Sparcl1 UTSW 5 104088490 missense probably benign 0.15
R4967:Sparcl1 UTSW 5 104092910 missense probably damaging 1.00
R5095:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5103:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5105:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5140:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5149:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R6245:Sparcl1 UTSW 5 104085147 missense probably damaging 1.00
R6387:Sparcl1 UTSW 5 104085060 missense probably damaging 1.00
R6544:Sparcl1 UTSW 5 104092444 nonsense probably null
R6930:Sparcl1 UTSW 5 104087074 missense probably damaging 1.00
R7246:Sparcl1 UTSW 5 104085157 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACTCACTATCGCGATTCGGG -3'
(R):5'- TTATTTGAACCAGGCTTCATGC -3'

Sequencing Primer
(F):5'- GCCACGTCCAATTATTTTCTAAGTG -3'
(R):5'- GTAAGAGTGACACGTGACA -3'
Posted On2014-10-30