Incidental Mutation 'R2331:Gm10295'
ID245874
Institutional Source Beutler Lab
Gene Symbol Gm10295
Ensembl Gene ENSMUSG00000070511
Gene Namepredicted gene 10295
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2331 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location71348961-71351485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 71350689 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 48 (S48A)
Ref Sequence ENSEMBL: ENSMUSP00000091873 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000094315
AA Change: S48A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209182
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C T 1: 38,204,890 probably null Het
Cadps A G 14: 12,603,692 I376T probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gstcd A G 3: 132,998,880 C538R probably damaging Het
Hcn3 A T 3: 89,148,090 S617T probably benign Het
Hectd4 A G 5: 121,320,026 I752V probably benign Het
Itgb7 G T 15: 102,223,548 T200K probably damaging Het
Lcn11 C A 2: 25,780,176 T177K possibly damaging Het
Lsm14a A G 7: 34,357,490 V241A probably benign Het
Magi1 T C 6: 93,685,562 K1075E probably damaging Het
Olfr1216 T C 2: 89,013,921 I48V probably benign Het
Olfr1426 C A 19: 12,088,158 L211F probably benign Het
P4hb T C 11: 120,568,280 N129S probably benign Het
Piezo1 C T 8: 122,487,266 probably null Het
Ppp3ca T C 3: 136,797,819 M51T probably benign Het
Sema6d T C 2: 124,658,063 V353A probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Sh3rf2 T C 18: 42,053,863 F16L probably benign Het
Sparcl1 A G 5: 104,085,794 L563P probably damaging Het
Stra6l T C 4: 45,858,224 probably null Het
Sult2a6 A T 7: 14,225,870 M246K possibly damaging Het
Trpv5 A G 6: 41,659,968 S399P probably damaging Het
Uggt2 A T 14: 119,026,599 F1006L possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Wdr72 A G 9: 74,148,326 Y279C probably damaging Het
Other mutations in Gm10295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Gm10295 APN 7 71350658 missense unknown
IGL01081:Gm10295 APN 7 71350548 missense unknown
IGL02942:Gm10295 APN 7 71350502 missense unknown
R0360:Gm10295 UTSW 7 71350613 missense unknown
R0364:Gm10295 UTSW 7 71350613 missense unknown
R1029:Gm10295 UTSW 7 71350700 missense unknown
X0027:Gm10295 UTSW 7 71350505 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTGGCAGTAAGTCTCAAACTC -3'
(R):5'- CCATTCGGTGTAGAGTGTCC -3'

Sequencing Primer
(F):5'- GCAGTAAGTCTCAAACTCTGCTC -3'
(R):5'- CGGTGTAGAGTGTCCTTTTAAAACTC -3'
Posted On2014-10-30