Incidental Mutation 'R2331:P4hb'
ID245878
Institutional Source Beutler Lab
Gene Symbol P4hb
Ensembl Gene ENSMUSG00000025130
Gene Nameprolyl 4-hydroxylase, beta polypeptide
SynonymsThbp, protein disulfide isomerase, ERp59, PDI, Pdia1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R2331 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120560298-120573253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120568280 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 129 (N129S)
Ref Sequence ENSEMBL: ENSMUSP00000026122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026122] [ENSMUST00000168360]
Predicted Effect probably benign
Transcript: ENSMUST00000026122
AA Change: N129S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026122
Gene: ENSMUSG00000025130
AA Change: N129S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Thioredoxin 27 134 4.9e-37 PFAM
Pfam:Thioredoxin_2 39 126 3.5e-9 PFAM
Pfam:Thioredoxin_6 163 347 8.3e-44 PFAM
Pfam:Thioredoxin 370 475 1.5e-30 PFAM
low complexity region 478 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168360
SMART Domains Protein: ENSMUSP00000128796
Gene: ENSMUSG00000025130

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Thioredoxin 27 131 6e-32 PFAM
low complexity region 134 157 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S-nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-out allele and conditional allele activated in immune cells exhibit impaired neutrophil recruitment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C T 1: 38,204,890 probably null Het
Cadps A G 14: 12,603,692 I376T probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gm10295 A C 7: 71,350,689 S48A unknown Het
Gstcd A G 3: 132,998,880 C538R probably damaging Het
Hcn3 A T 3: 89,148,090 S617T probably benign Het
Hectd4 A G 5: 121,320,026 I752V probably benign Het
Itgb7 G T 15: 102,223,548 T200K probably damaging Het
Lcn11 C A 2: 25,780,176 T177K possibly damaging Het
Lsm14a A G 7: 34,357,490 V241A probably benign Het
Magi1 T C 6: 93,685,562 K1075E probably damaging Het
Olfr1216 T C 2: 89,013,921 I48V probably benign Het
Olfr1426 C A 19: 12,088,158 L211F probably benign Het
Piezo1 C T 8: 122,487,266 probably null Het
Ppp3ca T C 3: 136,797,819 M51T probably benign Het
Sema6d T C 2: 124,658,063 V353A probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Sh3rf2 T C 18: 42,053,863 F16L probably benign Het
Sparcl1 A G 5: 104,085,794 L563P probably damaging Het
Stra6l T C 4: 45,858,224 probably null Het
Sult2a6 A T 7: 14,225,870 M246K possibly damaging Het
Trpv5 A G 6: 41,659,968 S399P probably damaging Het
Uggt2 A T 14: 119,026,599 F1006L possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Wdr72 A G 9: 74,148,326 Y279C probably damaging Het
Other mutations in P4hb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:P4hb APN 11 120563818 missense probably benign 0.00
R0042:P4hb UTSW 11 120568266 missense probably damaging 1.00
R0042:P4hb UTSW 11 120568266 missense probably damaging 1.00
R0362:P4hb UTSW 11 120563336 missense probably benign 0.04
R0597:P4hb UTSW 11 120568244 missense possibly damaging 0.53
R1458:P4hb UTSW 11 120562555 splice site probably benign
R1635:P4hb UTSW 11 120571616 missense probably damaging 0.97
R1750:P4hb UTSW 11 120562720 missense probably damaging 0.99
R1773:P4hb UTSW 11 120572726 missense probably damaging 1.00
R1856:P4hb UTSW 11 120563218 missense probably benign 0.23
R1874:P4hb UTSW 11 120562166 missense probably benign
R2014:P4hb UTSW 11 120562696 missense probably damaging 0.98
R2239:P4hb UTSW 11 120563282 missense probably damaging 1.00
R3935:P4hb UTSW 11 120562409 missense probably benign 0.20
R3936:P4hb UTSW 11 120562409 missense probably benign 0.20
R5601:P4hb UTSW 11 120571615 missense possibly damaging 0.90
R5893:P4hb UTSW 11 120571650 missense probably damaging 1.00
R6533:P4hb UTSW 11 120571643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGGCAGAGTCTGACTC -3'
(R):5'- TGGAATCCAGAGGCTGTAGC -3'

Sequencing Primer
(F):5'- GAGTCTGACTCTACGTCCTAGAATAG -3'
(R):5'- CTGTAGCCAGTTCTCTATAGGAG -3'
Posted On2014-10-30