Incidental Mutation 'R2343:Lman2l'
ID 245889
Institutional Source Beutler Lab
Gene Symbol Lman2l
Ensembl Gene ENSMUSG00000001143
Gene Name lectin, mannose-binding 2-like
Synonyms A630028F14Rik, VIP36-like
Accession Numbers
Essential gene? Probably essential (E-score: 0.781) question?
Stock # R2343 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 36419871-36445271 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36428109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 269 (D269E)
Ref Sequence ENSEMBL: ENSMUSP00000110663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001171] [ENSMUST00000115011] [ENSMUST00000123583] [ENSMUST00000125304]
AlphaFold P59481
Predicted Effect probably benign
Transcript: ENSMUST00000001171
SMART Domains Protein: ENSMUSP00000137028
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 146 1.5e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115011
AA Change: D269E

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110663
Gene: ENSMUSG00000001143
AA Change: D269E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 286 2e-84 PFAM
transmembrane domain 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123583
SMART Domains Protein: ENSMUSP00000137344
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125304
AA Change: D258E

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117200
Gene: ENSMUSG00000001143
AA Change: D258E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 275 3.2e-88 PFAM
transmembrane domain 313 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134594
Predicted Effect unknown
Transcript: ENSMUST00000152088
AA Change: D58E
SMART Domains Protein: ENSMUSP00000119798
Gene: ENSMUSG00000001143
AA Change: D58E

DomainStartEndE-ValueType
Pfam:Lectin_leg-like 1 76 1.3e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000192969
AA Change: D137E
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the L-type lectin group of type 1 membrane proteins, which function in the mammalian early secretory pathway. These proteins contain luminal carbohydrate recognition domains, which display homology to leguminous lectins. Unlike other proteins of the group, which cycle in the early secretory pathway and are predominantly associated with post endoplasmic reticulum membranes, the protein encoded by this gene is a non-cycling resident protein of the ER, where it functions as a cargo receptor for glycoproteins. It is proposed to regulate exchange of folded proteins for transport to the Golgi and exchange of misfolded glycoproteins for transport to the ubiquitin-proteasome pathway. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 75,145,422 I691T probably benign Het
Col20a1 A G 2: 181,001,331 T865A possibly damaging Het
Dmxl1 G A 18: 49,890,678 R1676H probably damaging Het
Dsg2 T C 18: 20,602,298 V1111A probably damaging Het
Eif3g T C 9: 20,895,154 Y213C probably damaging Het
Fat4 C T 3: 38,957,105 S2118F probably damaging Het
Gpr85 A G 6: 13,836,696 S70P probably damaging Het
Krtap31-1 A C 11: 99,908,021 T17P possibly damaging Het
Lig1 A G 7: 13,292,195 probably null Het
Mcc A G 18: 44,459,797 probably null Het
Nav2 T C 7: 49,598,817 F2302L possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1282 A G 2: 111,335,700 I126T probably damaging Het
Olfr1342 C A 4: 118,690,187 M88I probably benign Het
Sema6c T C 3: 95,167,083 F67L probably damaging Het
Sez6l A T 5: 112,464,731 V448D probably damaging Het
Smoc2 A G 17: 14,344,342 K160R probably benign Het
Spata2 A T 2: 167,483,360 V513E probably damaging Het
Susd3 T A 13: 49,238,859 M107L probably damaging Het
Tnni3k A G 3: 154,938,829 I564T probably benign Het
Zfp971 A G 2: 178,032,994 K129E possibly damaging Het
Other mutations in Lman2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lman2l APN 1 36438834 critical splice acceptor site probably null
IGL02301:Lman2l APN 1 36443543 missense probably damaging 1.00
IGL03288:Lman2l APN 1 36443547 missense probably damaging 0.98
IGL03295:Lman2l APN 1 36438811 missense probably damaging 1.00
R0128:Lman2l UTSW 1 36424864 nonsense probably null
R0130:Lman2l UTSW 1 36424864 nonsense probably null
R0981:Lman2l UTSW 1 36445233 start codon destroyed unknown
R2010:Lman2l UTSW 1 36445181 nonsense probably null
R2039:Lman2l UTSW 1 36428454 missense probably damaging 1.00
R4195:Lman2l UTSW 1 36424941 missense probably damaging 0.98
R4394:Lman2l UTSW 1 36439723 missense probably damaging 1.00
R4526:Lman2l UTSW 1 36438763 missense probably damaging 0.98
R5747:Lman2l UTSW 1 36424957 missense possibly damaging 0.90
R6156:Lman2l UTSW 1 36438826 missense probably damaging 1.00
R6264:Lman2l UTSW 1 36438769 missense probably damaging 1.00
R7013:Lman2l UTSW 1 36443518 unclassified probably benign
R9189:Lman2l UTSW 1 36439690 missense probably damaging 1.00
R9356:Lman2l UTSW 1 36428334 missense probably damaging 1.00
R9577:Lman2l UTSW 1 36428409 missense probably damaging 1.00
Z1176:Lman2l UTSW 1 36428376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAACTGTCCCAAAGGAG -3'
(R):5'- TCAAGAGGCATCTGACGGTG -3'

Sequencing Primer
(F):5'- TGTCCCAAAGGAGCCTGGATTG -3'
(R):5'- GAGTCCTGTCTTAGAGCAGC -3'
Posted On 2014-10-30