Incidental Mutation 'R2343:Olfr1282'
ID 245890
Institutional Source Beutler Lab
Gene Symbol Olfr1282
Ensembl Gene ENSMUSG00000096554
Gene Name olfactory receptor 1282
Synonyms MOR248-2, Olfr1557, GA_x6K02T2Q125-72387537-72386620, MOR248-16
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R2343 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 111335159-111336076 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111335700 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 126 (I126T)
Ref Sequence ENSEMBL: ENSMUSP00000097213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099618] [ENSMUST00000208176]
AlphaFold Q7TQY5
Predicted Effect probably damaging
Transcript: ENSMUST00000099618
AA Change: I126T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097213
Gene: ENSMUSG00000096554
AA Change: I126T

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.5e-47 PFAM
Pfam:7tm_1 41 287 2.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208176
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 75,145,422 I691T probably benign Het
Col20a1 A G 2: 181,001,331 T865A possibly damaging Het
Dmxl1 G A 18: 49,890,678 R1676H probably damaging Het
Dsg2 T C 18: 20,602,298 V1111A probably damaging Het
Eif3g T C 9: 20,895,154 Y213C probably damaging Het
Fat4 C T 3: 38,957,105 S2118F probably damaging Het
Gpr85 A G 6: 13,836,696 S70P probably damaging Het
Krtap31-1 A C 11: 99,908,021 T17P possibly damaging Het
Lig1 A G 7: 13,292,195 probably null Het
Lman2l A T 1: 36,428,109 D269E possibly damaging Het
Mcc A G 18: 44,459,797 probably null Het
Nav2 T C 7: 49,598,817 F2302L possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1342 C A 4: 118,690,187 M88I probably benign Het
Sema6c T C 3: 95,167,083 F67L probably damaging Het
Sez6l A T 5: 112,464,731 V448D probably damaging Het
Smoc2 A G 17: 14,344,342 K160R probably benign Het
Spata2 A T 2: 167,483,360 V513E probably damaging Het
Susd3 T A 13: 49,238,859 M107L probably damaging Het
Tnni3k A G 3: 154,938,829 I564T probably benign Het
Zfp971 A G 2: 178,032,994 K129E possibly damaging Het
Other mutations in Olfr1282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02677:Olfr1282 APN 2 111335802 missense probably damaging 1.00
R0798:Olfr1282 UTSW 2 111335344 missense probably benign 0.16
R0932:Olfr1282 UTSW 2 111335198 missense probably benign 0.00
R0972:Olfr1282 UTSW 2 111335418 missense probably benign 0.18
R1033:Olfr1282 UTSW 2 111335802 missense probably damaging 1.00
R1864:Olfr1282 UTSW 2 111335707 missense possibly damaging 0.95
R1879:Olfr1282 UTSW 2 111335463 missense possibly damaging 0.61
R2509:Olfr1282 UTSW 2 111335731 missense probably damaging 0.98
R3620:Olfr1282 UTSW 2 111335344 missense probably benign 0.06
R5589:Olfr1282 UTSW 2 111335505 missense possibly damaging 0.46
R6487:Olfr1282 UTSW 2 111335667 missense probably benign 0.00
R6818:Olfr1282 UTSW 2 111335314 missense probably benign 0.22
R7153:Olfr1282 UTSW 2 111335901 missense probably damaging 1.00
R7480:Olfr1282 UTSW 2 111335392 missense probably benign 0.22
R7589:Olfr1282 UTSW 2 111335374 missense probably damaging 1.00
R8441:Olfr1282 UTSW 2 111335786 nonsense probably null
R8774:Olfr1282 UTSW 2 111335973 missense probably damaging 1.00
R8774-TAIL:Olfr1282 UTSW 2 111335973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGCTAATTTCATCACCAAAG -3'
(R):5'- CTCTACCTGATGGCTGTGGTAG -3'

Sequencing Primer
(F):5'- TTTCATCACCAAAGGAATATCACAG -3'
(R):5'- CAACCTGTTTGTTGTGATATTGATC -3'
Posted On 2014-10-30