Incidental Mutation 'R2343:Zfp971'
ID245892
Institutional Source Beutler Lab
Gene Symbol Zfp971
Ensembl Gene ENSMUSG00000074519
Gene Namezinc finger protein 971
SynonymsEtohi1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2343 (G1)
Quality Score201
Status Not validated
Chromosome2
Chromosomal Location178023284-178034022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 178032994 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 129 (K129E)
Ref Sequence ENSEMBL: ENSMUSP00000104554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108925] [ENSMUST00000108926]
Predicted Effect probably benign
Transcript: ENSMUST00000108925
SMART Domains Protein: ENSMUSP00000104553
Gene: ENSMUSG00000074519

DomainStartEndE-ValueType
KRAB 4 64 1.2e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108926
AA Change: K129E

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104554
Gene: ENSMUSG00000074519
AA Change: K129E

DomainStartEndE-ValueType
KRAB 4 66 1.6e-13 SMART
ZnF_C2H2 78 97 1.38e2 SMART
ZnF_C2H2 103 125 4.38e1 SMART
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 4.79e-3 SMART
ZnF_C2H2 187 209 2.36e-2 SMART
ZnF_C2H2 215 237 2.36e-2 SMART
ZnF_C2H2 243 265 3.69e-4 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 4.4e-2 SMART
ZnF_C2H2 327 349 4.61e-5 SMART
ZnF_C2H2 355 377 4.94e-5 SMART
ZnF_C2H2 383 405 3.21e-4 SMART
ZnF_C2H2 411 433 4.47e-3 SMART
ZnF_C2H2 439 461 5.99e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181241
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcr T C 10: 75,145,422 I691T probably benign Het
Col20a1 A G 2: 181,001,331 T865A possibly damaging Het
Dmxl1 G A 18: 49,890,678 R1676H probably damaging Het
Dsg2 T C 18: 20,602,298 V1111A probably damaging Het
Eif3g T C 9: 20,895,154 Y213C probably damaging Het
Fat4 C T 3: 38,957,105 S2118F probably damaging Het
Gpr85 A G 6: 13,836,696 S70P probably damaging Het
Krtap31-1 A C 11: 99,908,021 T17P possibly damaging Het
Lig1 A G 7: 13,292,195 probably null Het
Lman2l A T 1: 36,428,109 D269E possibly damaging Het
Mcc A G 18: 44,459,797 probably null Het
Nav2 T C 7: 49,598,817 F2302L possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1282 A G 2: 111,335,700 I126T probably damaging Het
Olfr1342 C A 4: 118,690,187 M88I probably benign Het
Sema6c T C 3: 95,167,083 F67L probably damaging Het
Sez6l A T 5: 112,464,731 V448D probably damaging Het
Smoc2 A G 17: 14,344,342 K160R probably benign Het
Spata2 A T 2: 167,483,360 V513E probably damaging Het
Susd3 T A 13: 49,238,859 M107L probably damaging Het
Tnni3k A G 3: 154,938,829 I564T probably benign Het
Other mutations in Zfp971
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Zfp971 APN 2 178023382 critical splice donor site probably null
R1108:Zfp971 UTSW 2 178033670 missense probably damaging 1.00
R1759:Zfp971 UTSW 2 178033929 missense probably damaging 0.99
R2183:Zfp971 UTSW 2 178033740 missense probably damaging 1.00
R4873:Zfp971 UTSW 2 178033147 missense probably benign 0.24
R4875:Zfp971 UTSW 2 178033147 missense probably benign 0.24
R5263:Zfp971 UTSW 2 178033762 missense probably damaging 1.00
R5396:Zfp971 UTSW 2 178033733 missense probably damaging 1.00
R6150:Zfp971 UTSW 2 178033454 missense probably benign 0.26
R6693:Zfp971 UTSW 2 178033431 missense probably benign 0.01
R6811:Zfp971 UTSW 2 178033881 missense possibly damaging 0.62
R7427:Zfp971 UTSW 2 178033174 missense probably damaging 1.00
R7428:Zfp971 UTSW 2 178033174 missense probably damaging 1.00
R7594:Zfp971 UTSW 2 178034000 missense possibly damaging 0.47
R7790:Zfp971 UTSW 2 178033499 missense probably damaging 0.96
R7796:Zfp971 UTSW 2 178031610 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATGAAAGAAGTTCTTCTGCAG -3'
(R):5'- TACTGCAAAGGCTTTACCACATTG -3'

Sequencing Primer
(F):5'- GAAGTTCTTCTGCAGAGCAAC -3'
(R):5'- GCAAAGGCTTTACCACATTGTTTAC -3'
Posted On2014-10-30